Skip to content

ABHelix

Here we will discuss how to process BCR cDNA libraries obtained with ABHelix kit.

Data libraries

This tutorial uses the data from the following publication: High frequency of shared clonotypes in human B cell receptor repertoires. Soto C et al., , Nature, 2019 Feb;566(7744):398-402 doi: 10.1038/s41586-019-0934-8

Peripheral blood samples were collected from three donors : HIP1 (female, 47 y.o.), HIP2 (male, 22 y.o.) and HIP3(male, 29 y.o.). Samples were collected in multiple replicas. Total RNA was extracted from PBMCs and multiple reactions of reverse transcription were combined and purified using magnetic beads. The purified RT products were divided evenly for the first round of PCR amplification specific to human IgG, IgL IgK, IgM, or IgA. The 5' multiplex PCR primers were designed within the leader sequences of each productive V gene and the 3' primers within the constant regions, but in close approximation to the J gene/constant region junctions. The resulting first-round PCR products were purified with magnetic beads and subjected to the second round of PCR amplification to add Illumina index and adapter sequences. Subsequent amplicon libraries were sequenced using next-generation sequencing. Paired end sequencing was performed on Illumina HiSeq 2500, R1 and R2 are 250bp long.

All data is available from SRA (PRJNA511481) using e.g. SRA Explorer.

Use aria2c for efficient download of the full dataset with the proper filenames:

download.sh
mkdir -p raw
aria2c -c -s 16 -x 16 -k 1M -j 8 -i download-list.txt
download-list.txt
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365277/SRR8365277_1.fastq.gz
  out=raw/SRR8365277_HIP1_female_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365278/SRR8365278_1.fastq.gz
  out=raw/SRR8365278_HIP1_female_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365279/SRR8365279_1.fastq.gz
  out=raw/SRR8365279_HIP1_female_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365280/SRR8365280_1.fastq.gz
  out=raw/SRR8365280_HIP1_female_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365281/SRR8365281_1.fastq.gz
  out=raw/SRR8365281_HIP1_female_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365282/SRR8365282_1.fastq.gz
  out=raw/SRR8365282_HIP1_female_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365283/SRR8365283_1.fastq.gz
  out=raw/SRR8365283_HIP1_female_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365284/SRR8365284_1.fastq.gz
  out=raw/SRR8365284_HIP1_female_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365285/SRR8365285_1.fastq.gz
  out=raw/SRR8365285_HIP2_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365286/SRR8365286_1.fastq.gz
  out=raw/SRR8365286_HIP2_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365287/SRR8365287_1.fastq.gz
  out=raw/SRR8365287_HIP2_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365288/SRR8365288_1.fastq.gz
  out=raw/SRR8365288_HIP2_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365289/SRR8365289_1.fastq.gz
  out=raw/SRR8365289_HIP2_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365290/SRR8365290_1.fastq.gz
  out=raw/SRR8365290_HIP2_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365291/SRR8365291_1.fastq.gz
  out=raw/SRR8365291_HIP2_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365292/SRR8365292_1.fastq.gz
  out=raw/SRR8365292_HIP2_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365293/SRR8365293_1.fastq.gz
  out=raw/SRR8365293_HIP3_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365294/SRR8365294_1.fastq.gz
  out=raw/SRR8365294_HIP3_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365295/SRR8365295_1.fastq.gz
  out=raw/SRR8365295_HIP3_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365296/SRR8365296_1.fastq.gz
  out=raw/SRR8365296_HIP3_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365297/SRR8365297_1.fastq.gz
  out=raw/SRR8365297_HIP2_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365298/SRR8365298_1.fastq.gz
  out=raw/SRR8365298_HIP2_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365299/SRR8365299_1.fastq.gz
  out=raw/SRR8365299_HIP3_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365300/SRR8365300_1.fastq.gz
  out=raw/SRR8365300_HIP3_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365311/SRR8365311_1.fastq.gz
  out=raw/SRR8365311_HIP1_female_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365312/SRR8365312_1.fastq.gz
  out=raw/SRR8365312_HIP1_female_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365313/SRR8365313_1.fastq.gz
  out=raw/SRR8365313_HIP1_female_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365314/SRR8365314_1.fastq.gz
  out=raw/SRR8365314_HIP1_female_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365315/SRR8365315_1.fastq.gz
  out=raw/SRR8365315_HIP1_female_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365316/SRR8365316_1.fastq.gz
  out=raw/SRR8365316_HIP1_female_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365317/SRR8365317_1.fastq.gz
  out=raw/SRR8365317_HIP1_female_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365318/SRR8365318_1.fastq.gz
  out=raw/SRR8365318_HIP1_female_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365319/SRR8365319_1.fastq.gz
  out=raw/SRR8365319_HIP1_female_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365320/SRR8365320_1.fastq.gz
  out=raw/SRR8365320_HIP1_female_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365323/SRR8365323_1.fastq.gz
  out=raw/SRR8365323_HIP3_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365332/SRR8365332_1.fastq.gz
  out=raw/SRR8365332_HIP2_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365333/SRR8365333_1.fastq.gz
  out=raw/SRR8365333_HIP2_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365334/SRR8365334_1.fastq.gz
  out=raw/SRR8365334_HIP2_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365335/SRR8365335_1.fastq.gz
  out=raw/SRR8365335_HIP2_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365336/SRR8365336_1.fastq.gz
  out=raw/SRR8365336_HIP2_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365337/SRR8365337_1.fastq.gz
  out=raw/SRR8365337_HIP2_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365338/SRR8365338_1.fastq.gz
  out=raw/SRR8365338_HIP2_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365339/SRR8365339_1.fastq.gz
  out=raw/SRR8365339_HIP2_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365340/SRR8365340_1.fastq.gz
  out=raw/SRR8365340_HIP3_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365341/SRR8365341_1.fastq.gz
  out=raw/SRR8365341_HIP3_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365342/SRR8365342_1.fastq.gz
  out=raw/SRR8365342_HIP2_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365343/SRR8365343_1.fastq.gz
  out=raw/SRR8365343_HIP2_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365344/SRR8365344_1.fastq.gz
  out=raw/SRR8365344_HIP3_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365345/SRR8365345_1.fastq.gz
  out=raw/SRR8365345_HIP3_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365346/SRR8365346_1.fastq.gz
  out=raw/SRR8365346_HIP3_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365347/SRR8365347_1.fastq.gz
  out=raw/SRR8365347_HIP3_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365349/SRR8365349_1.fastq.gz
  out=raw/SRR8365349_HIP2_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365350/SRR8365350_1.fastq.gz
  out=raw/SRR8365350_HIP2_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365351/SRR8365351_1.fastq.gz
  out=raw/SRR8365351_HIP2_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365352/SRR8365352_1.fastq.gz
  out=raw/SRR8365352_HIP2_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365353/SRR8365353_1.fastq.gz
  out=raw/SRR8365353_HIP2_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365354/SRR8365354_1.fastq.gz
  out=raw/SRR8365354_HIP2_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365355/SRR8365355_1.fastq.gz
  out=raw/SRR8365355_HIP2_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365356/SRR8365356_1.fastq.gz
  out=raw/SRR8365356_HIP2_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365357/SRR8365357_1.fastq.gz
  out=raw/SRR8365357_HIP2_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365358/SRR8365358_1.fastq.gz
  out=raw/SRR8365358_HIP2_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365359/SRR8365359_1.fastq.gz
  out=raw/SRR8365359_HIP3_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365360/SRR8365360_1.fastq.gz
  out=raw/SRR8365360_HIP3_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365361/SRR8365361_1.fastq.gz
  out=raw/SRR8365361_HIP3_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365362/SRR8365362_1.fastq.gz
  out=raw/SRR8365362_HIP3_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365363/SRR8365363_1.fastq.gz
  out=raw/SRR8365363_HIP3_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365364/SRR8365364_1.fastq.gz
  out=raw/SRR8365364_HIP3_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365365/SRR8365365_1.fastq.gz
  out=raw/SRR8365365_HIP3_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365366/SRR8365366_1.fastq.gz
  out=raw/SRR8365366_HIP3_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365367/SRR8365367_1.fastq.gz
  out=raw/SRR8365367_HIP3_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365368/SRR8365368_1.fastq.gz
  out=raw/SRR8365368_HIP3_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365369/SRR8365369_1.fastq.gz
  out=raw/SRR8365369_HIP3_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365370/SRR8365370_1.fastq.gz
  out=raw/SRR8365370_HIP2_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365371/SRR8365371_1.fastq.gz
  out=raw/SRR8365371_HIP2_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365372/SRR8365372_1.fastq.gz
  out=raw/SRR8365372_HIP3_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365373/SRR8365373_1.fastq.gz
  out=raw/SRR8365373_HIP2_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365374/SRR8365374_1.fastq.gz
  out=raw/SRR8365374_HIP2_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365375/SRR8365375_1.fastq.gz
  out=raw/SRR8365375_HIP2_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365376/SRR8365376_1.fastq.gz
  out=raw/SRR8365376_HIP2_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365377/SRR8365377_1.fastq.gz
  out=raw/SRR8365377_HIP2_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365378/SRR8365378_1.fastq.gz
  out=raw/SRR8365378_HIP2_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365379/SRR8365379_1.fastq.gz
  out=raw/SRR8365379_HIP2_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365380/SRR8365380_1.fastq.gz
  out=raw/SRR8365380_HIP2_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365381/SRR8365381_1.fastq.gz
  out=raw/SRR8365381_HIP3_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365382/SRR8365382_1.fastq.gz
  out=raw/SRR8365382_HIP3_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365383/SRR8365383_1.fastq.gz
  out=raw/SRR8365383_HIP3_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365384/SRR8365384_1.fastq.gz
  out=raw/SRR8365384_HIP3_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365385/SRR8365385_1.fastq.gz
  out=raw/SRR8365385_HIP3_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365386/SRR8365386_1.fastq.gz
  out=raw/SRR8365386_HIP3_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365387/SRR8365387_1.fastq.gz
  out=raw/SRR8365387_HIP3_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365388/SRR8365388_1.fastq.gz
  out=raw/SRR8365388_HIP3_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365389/SRR8365389_1.fastq.gz
  out=raw/SRR8365389_HIP3_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365390/SRR8365390_1.fastq.gz
  out=raw/SRR8365390_HIP3_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365391/SRR8365391_1.fastq.gz
  out=raw/SRR8365391_HIP1_female_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365392/SRR8365392_1.fastq.gz
  out=raw/SRR8365392_HIP1_female_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365393/SRR8365393_1.fastq.gz
  out=raw/SRR8365393_HIP1_female_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365394/SRR8365394_1.fastq.gz
  out=raw/SRR8365394_HIP1_female_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365395/SRR8365395_1.fastq.gz
  out=raw/SRR8365395_HIP1_female_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365396/SRR8365396_1.fastq.gz
  out=raw/SRR8365396_HIP1_female_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365397/SRR8365397_1.fastq.gz
  out=raw/SRR8365397_HIP1_female_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365398/SRR8365398_1.fastq.gz
  out=raw/SRR8365398_HIP1_female_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365399/SRR8365399_1.fastq.gz
  out=raw/SRR8365399_HIP1_female_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365400/SRR8365400_1.fastq.gz
  out=raw/SRR8365400_HIP1_female_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365401/SRR8365401_1.fastq.gz
  out=raw/SRR8365401_HIP3_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365402/SRR8365402_1.fastq.gz
  out=raw/SRR8365402_HIP3_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365413/SRR8365413_1.fastq.gz
  out=raw/SRR8365413_HIP3_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365414/SRR8365414_1.fastq.gz
  out=raw/SRR8365414_HIP3_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365415/SRR8365415_1.fastq.gz
  out=raw/SRR8365415_HIP3_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365416/SRR8365416_1.fastq.gz
  out=raw/SRR8365416_HIP3_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365417/SRR8365417_1.fastq.gz
  out=raw/SRR8365417_HIP3_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365425/SRR8365425_1.fastq.gz
  out=raw/SRR8365425_HIP3_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365426/SRR8365426_1.fastq.gz
  out=raw/SRR8365426_HIP3_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365427/SRR8365427_1.fastq.gz
  out=raw/SRR8365427_HIP3_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365428/SRR8365428_1.fastq.gz
  out=raw/SRR8365428_HIP1_female_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365429/SRR8365429_1.fastq.gz
  out=raw/SRR8365429_HIP1_female_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365430/SRR8365430_1.fastq.gz
  out=raw/SRR8365430_HIP1_female_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365431/SRR8365431_1.fastq.gz
  out=raw/SRR8365431_HIP1_female_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365432/SRR8365432_1.fastq.gz
  out=raw/SRR8365432_HIP1_female_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365433/SRR8365433_1.fastq.gz
  out=raw/SRR8365433_HIP1_female_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365442/SRR8365442_1.fastq.gz
  out=raw/SRR8365442_HIP3_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365445/SRR8365445_1.fastq.gz
  out=raw/SRR8365445_HIP3_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365451/SRR8365451_1.fastq.gz
  out=raw/SRR8365451_HIP2_male_IgG1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365452/SRR8365452_1.fastq.gz
  out=raw/SRR8365452_HIP2_male_IgG2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365453/SRR8365453_1.fastq.gz
  out=raw/SRR8365453_HIP2_male_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365454/SRR8365454_1.fastq.gz
  out=raw/SRR8365454_HIP2_male_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365455/SRR8365455_1.fastq.gz
  out=raw/SRR8365455_HIP2_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365466/SRR8365466_1.fastq.gz
  out=raw/SRR8365466_HIP3_male_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365472/SRR8365472_1.fastq.gz
  out=raw/SRR8365472_HIP2_male_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365476/SRR8365476_1.fastq.gz
  out=raw/SRR8365476_HIP2_male_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365477/SRR8365477_1.fastq.gz
  out=raw/SRR8365477_HIP2_male_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365478/SRR8365478_1.fastq.gz
  out=raw/SRR8365478_HIP1_female_IgL_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365479/SRR8365479_1.fastq.gz
  out=raw/SRR8365479_HIP1_female_IgK_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365480/SRR8365480_1.fastq.gz
  out=raw/SRR8365480_HIP1_female_IgA_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365481/SRR8365481_1.fastq.gz
  out=raw/SRR8365481_HIP1_female_IgM_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365486/SRR8365486_1.fastq.gz
  out=raw/SRR8365486_HIP1_female_IgG4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365487/SRR8365487_1.fastq.gz
  out=raw/SRR8365487_HIP1_female_IgG3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365277/SRR8365277_2.fastq.gz
  out=raw/SRR8365277_HIP1_female_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365278/SRR8365278_2.fastq.gz
  out=raw/SRR8365278_HIP1_female_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365279/SRR8365279_2.fastq.gz
  out=raw/SRR8365279_HIP1_female_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365280/SRR8365280_2.fastq.gz
  out=raw/SRR8365280_HIP1_female_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365281/SRR8365281_2.fastq.gz
  out=raw/SRR8365281_HIP1_female_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365282/SRR8365282_2.fastq.gz
  out=raw/SRR8365282_HIP1_female_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365283/SRR8365283_2.fastq.gz
  out=raw/SRR8365283_HIP1_female_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365284/SRR8365284_2.fastq.gz
  out=raw/SRR8365284_HIP1_female_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365285/SRR8365285_2.fastq.gz
  out=raw/SRR8365285_HIP2_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365286/SRR8365286_2.fastq.gz
  out=raw/SRR8365286_HIP2_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365287/SRR8365287_2.fastq.gz
  out=raw/SRR8365287_HIP2_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365288/SRR8365288_2.fastq.gz
  out=raw/SRR8365288_HIP2_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365289/SRR8365289_2.fastq.gz
  out=raw/SRR8365289_HIP2_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365290/SRR8365290_2.fastq.gz
  out=raw/SRR8365290_HIP2_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365291/SRR8365291_2.fastq.gz
  out=raw/SRR8365291_HIP2_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365292/SRR8365292_2.fastq.gz
  out=raw/SRR8365292_HIP2_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365293/SRR8365293_2.fastq.gz
  out=raw/SRR8365293_HIP3_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365294/SRR8365294_2.fastq.gz
  out=raw/SRR8365294_HIP3_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365295/SRR8365295_2.fastq.gz
  out=raw/SRR8365295_HIP3_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365296/SRR8365296_2.fastq.gz
  out=raw/SRR8365296_HIP3_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365297/SRR8365297_2.fastq.gz
  out=raw/SRR8365297_HIP2_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365298/SRR8365298_2.fastq.gz
  out=raw/SRR8365298_HIP2_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365299/SRR8365299_2.fastq.gz
  out=raw/SRR8365299_HIP3_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365300/SRR8365300_2.fastq.gz
  out=raw/SRR8365300_HIP3_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365311/SRR8365311_2.fastq.gz
  out=raw/SRR8365311_HIP1_female_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365312/SRR8365312_2.fastq.gz
  out=raw/SRR8365312_HIP1_female_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365313/SRR8365313_2.fastq.gz
  out=raw/SRR8365313_HIP1_female_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365314/SRR8365314_2.fastq.gz
  out=raw/SRR8365314_HIP1_female_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365315/SRR8365315_2.fastq.gz
  out=raw/SRR8365315_HIP1_female_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365316/SRR8365316_2.fastq.gz
  out=raw/SRR8365316_HIP1_female_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365317/SRR8365317_2.fastq.gz
  out=raw/SRR8365317_HIP1_female_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365318/SRR8365318_2.fastq.gz
  out=raw/SRR8365318_HIP1_female_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365319/SRR8365319_2.fastq.gz
  out=raw/SRR8365319_HIP1_female_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365320/SRR8365320_2.fastq.gz
  out=raw/SRR8365320_HIP1_female_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365323/SRR8365323_2.fastq.gz
  out=raw/SRR8365323_HIP3_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365332/SRR8365332_2.fastq.gz
  out=raw/SRR8365332_HIP2_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365333/SRR8365333_2.fastq.gz
  out=raw/SRR8365333_HIP2_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365334/SRR8365334_2.fastq.gz
  out=raw/SRR8365334_HIP2_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365335/SRR8365335_2.fastq.gz
  out=raw/SRR8365335_HIP2_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365336/SRR8365336_2.fastq.gz
  out=raw/SRR8365336_HIP2_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365337/SRR8365337_2.fastq.gz
  out=raw/SRR8365337_HIP2_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365338/SRR8365338_2.fastq.gz
  out=raw/SRR8365338_HIP2_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365339/SRR8365339_2.fastq.gz
  out=raw/SRR8365339_HIP2_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365340/SRR8365340_2.fastq.gz
  out=raw/SRR8365340_HIP3_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365341/SRR8365341_2.fastq.gz
  out=raw/SRR8365341_HIP3_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365342/SRR8365342_2.fastq.gz
  out=raw/SRR8365342_HIP2_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365343/SRR8365343_2.fastq.gz
  out=raw/SRR8365343_HIP2_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365344/SRR8365344_2.fastq.gz
  out=raw/SRR8365344_HIP3_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365345/SRR8365345_2.fastq.gz
  out=raw/SRR8365345_HIP3_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365346/SRR8365346_2.fastq.gz
  out=raw/SRR8365346_HIP3_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365347/SRR8365347_2.fastq.gz
  out=raw/SRR8365347_HIP3_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365349/SRR8365349_2.fastq.gz
  out=raw/SRR8365349_HIP2_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365350/SRR8365350_2.fastq.gz
  out=raw/SRR8365350_HIP2_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365351/SRR8365351_2.fastq.gz
  out=raw/SRR8365351_HIP2_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365352/SRR8365352_2.fastq.gz
  out=raw/SRR8365352_HIP2_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365353/SRR8365353_2.fastq.gz
  out=raw/SRR8365353_HIP2_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365354/SRR8365354_2.fastq.gz
  out=raw/SRR8365354_HIP2_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365355/SRR8365355_2.fastq.gz
  out=raw/SRR8365355_HIP2_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365356/SRR8365356_2.fastq.gz
  out=raw/SRR8365356_HIP2_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365357/SRR8365357_2.fastq.gz
  out=raw/SRR8365357_HIP2_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365358/SRR8365358_2.fastq.gz
  out=raw/SRR8365358_HIP2_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365359/SRR8365359_2.fastq.gz
  out=raw/SRR8365359_HIP3_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365360/SRR8365360_2.fastq.gz
  out=raw/SRR8365360_HIP3_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365361/SRR8365361_2.fastq.gz
  out=raw/SRR8365361_HIP3_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365362/SRR8365362_2.fastq.gz
  out=raw/SRR8365362_HIP3_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365363/SRR8365363_2.fastq.gz
  out=raw/SRR8365363_HIP3_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365364/SRR8365364_2.fastq.gz
  out=raw/SRR8365364_HIP3_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365365/SRR8365365_2.fastq.gz
  out=raw/SRR8365365_HIP3_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365366/SRR8365366_2.fastq.gz
  out=raw/SRR8365366_HIP3_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365367/SRR8365367_2.fastq.gz
  out=raw/SRR8365367_HIP3_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365368/SRR8365368_2.fastq.gz
  out=raw/SRR8365368_HIP3_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365369/SRR8365369_2.fastq.gz
  out=raw/SRR8365369_HIP3_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365370/SRR8365370_2.fastq.gz
  out=raw/SRR8365370_HIP2_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365371/SRR8365371_2.fastq.gz
  out=raw/SRR8365371_HIP2_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365372/SRR8365372_2.fastq.gz
  out=raw/SRR8365372_HIP3_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365373/SRR8365373_2.fastq.gz
  out=raw/SRR8365373_HIP2_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365374/SRR8365374_2.fastq.gz
  out=raw/SRR8365374_HIP2_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365375/SRR8365375_2.fastq.gz
  out=raw/SRR8365375_HIP2_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365376/SRR8365376_2.fastq.gz
  out=raw/SRR8365376_HIP2_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365377/SRR8365377_2.fastq.gz
  out=raw/SRR8365377_HIP2_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365378/SRR8365378_2.fastq.gz
  out=raw/SRR8365378_HIP2_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365379/SRR8365379_2.fastq.gz
  out=raw/SRR8365379_HIP2_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365380/SRR8365380_2.fastq.gz
  out=raw/SRR8365380_HIP2_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365381/SRR8365381_2.fastq.gz
  out=raw/SRR8365381_HIP3_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365382/SRR8365382_2.fastq.gz
  out=raw/SRR8365382_HIP3_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365383/SRR8365383_2.fastq.gz
  out=raw/SRR8365383_HIP3_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365384/SRR8365384_2.fastq.gz
  out=raw/SRR8365384_HIP3_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365385/SRR8365385_2.fastq.gz
  out=raw/SRR8365385_HIP3_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365386/SRR8365386_2.fastq.gz
  out=raw/SRR8365386_HIP3_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365387/SRR8365387_2.fastq.gz
  out=raw/SRR8365387_HIP3_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365388/SRR8365388_2.fastq.gz
  out=raw/SRR8365388_HIP3_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365389/SRR8365389_2.fastq.gz
  out=raw/SRR8365389_HIP3_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365390/SRR8365390_2.fastq.gz
  out=raw/SRR8365390_HIP3_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365391/SRR8365391_2.fastq.gz
  out=raw/SRR8365391_HIP1_female_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365392/SRR8365392_2.fastq.gz
  out=raw/SRR8365392_HIP1_female_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365393/SRR8365393_2.fastq.gz
  out=raw/SRR8365393_HIP1_female_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365394/SRR8365394_2.fastq.gz
  out=raw/SRR8365394_HIP1_female_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365395/SRR8365395_2.fastq.gz
  out=raw/SRR8365395_HIP1_female_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365396/SRR8365396_2.fastq.gz
  out=raw/SRR8365396_HIP1_female_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365397/SRR8365397_2.fastq.gz
  out=raw/SRR8365397_HIP1_female_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365398/SRR8365398_2.fastq.gz
  out=raw/SRR8365398_HIP1_female_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365399/SRR8365399_2.fastq.gz
  out=raw/SRR8365399_HIP1_female_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365400/SRR8365400_2.fastq.gz
  out=raw/SRR8365400_HIP1_female_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365401/SRR8365401_2.fastq.gz
  out=raw/SRR8365401_HIP3_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365402/SRR8365402_2.fastq.gz
  out=raw/SRR8365402_HIP3_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365413/SRR8365413_2.fastq.gz
  out=raw/SRR8365413_HIP3_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365414/SRR8365414_2.fastq.gz
  out=raw/SRR8365414_HIP3_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365415/SRR8365415_2.fastq.gz
  out=raw/SRR8365415_HIP3_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365416/SRR8365416_2.fastq.gz
  out=raw/SRR8365416_HIP3_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365417/SRR8365417_2.fastq.gz
  out=raw/SRR8365417_HIP3_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365425/SRR8365425_2.fastq.gz
  out=raw/SRR8365425_HIP3_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365426/SRR8365426_2.fastq.gz
  out=raw/SRR8365426_HIP3_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365427/SRR8365427_2.fastq.gz
  out=raw/SRR8365427_HIP3_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365428/SRR8365428_2.fastq.gz
  out=raw/SRR8365428_HIP1_female_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365429/SRR8365429_2.fastq.gz
  out=raw/SRR8365429_HIP1_female_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365430/SRR8365430_2.fastq.gz
  out=raw/SRR8365430_HIP1_female_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365431/SRR8365431_2.fastq.gz
  out=raw/SRR8365431_HIP1_female_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365432/SRR8365432_2.fastq.gz
  out=raw/SRR8365432_HIP1_female_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365433/SRR8365433_2.fastq.gz
  out=raw/SRR8365433_HIP1_female_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365442/SRR8365442_2.fastq.gz
  out=raw/SRR8365442_HIP3_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365445/SRR8365445_2.fastq.gz
  out=raw/SRR8365445_HIP3_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365451/SRR8365451_2.fastq.gz
  out=raw/SRR8365451_HIP2_male_IgG1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365452/SRR8365452_2.fastq.gz
  out=raw/SRR8365452_HIP2_male_IgG2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/003/SRR8365453/SRR8365453_2.fastq.gz
  out=raw/SRR8365453_HIP2_male_IgG3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/004/SRR8365454/SRR8365454_2.fastq.gz
  out=raw/SRR8365454_HIP2_male_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/005/SRR8365455/SRR8365455_2.fastq.gz
  out=raw/SRR8365455_HIP2_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365466/SRR8365466_2.fastq.gz
  out=raw/SRR8365466_HIP3_male_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/002/SRR8365472/SRR8365472_2.fastq.gz
  out=raw/SRR8365472_HIP2_male_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365476/SRR8365476_2.fastq.gz
  out=raw/SRR8365476_HIP2_male_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365477/SRR8365477_2.fastq.gz
  out=raw/SRR8365477_HIP2_male_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/008/SRR8365478/SRR8365478_2.fastq.gz
  out=raw/SRR8365478_HIP1_female_IgL_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/009/SRR8365479/SRR8365479_2.fastq.gz
  out=raw/SRR8365479_HIP1_female_IgK_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/000/SRR8365480/SRR8365480_2.fastq.gz
  out=raw/SRR8365480_HIP1_female_IgA_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/001/SRR8365481/SRR8365481_2.fastq.gz
  out=raw/SRR8365481_HIP1_female_IgM_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/006/SRR8365486/SRR8365486_2.fastq.gz
  out=raw/SRR8365486_HIP1_female_IgG4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR836/007/SRR8365487/SRR8365487_2.fastq.gz
  out=raw/SRR8365487_HIP1_female_IgG3_R2.fastq.gz

The project contains 136 FASTQ file pairs. The above script downloads all the data to raw/ folder. Each file name encodes the data about the donor, its sex and Ig chain. For example for the first file from the above list:

  • SRR8365277 - sample id
  • HIP1 - patient id
  • female - patient sex
  • IgG1 - Ig heavy chain, isotype IGG1.

The structure of the library is shown on the picture bellow.

It is worth noticing, that reads in IgA and IgM cDNA libraries samples cover about 20 and 21 base pairs of C gene, accordingly. In the original paper authors say that these samples were processed at AbHelix, LLC (www.AbHelix.com, South Plainfield, NJ, USA) and briefly emphasise: "For IgG sequencing reads, subclass-specific sequences in the beginning of the constant regions were used for identifying IgG1, IgG2, IgG3, and IgG4 subclass sequences." But, the reads in IgG subtypes samples (IgG1,IgG2,IgG3,IgG4) only cover last 5 nucleotides of the C gene. It is not clear how these subclasses were identified. Nevertheless, we will process all samples as if the primers are located on the J gene/constant region junctions for two reasons:

  • For IgA and IgM we don't know what part of the sequence comes from the primers, and IgG cDNA libraries presumably were amplifies using J-C junction primer, since only 5 nucleotides of the C gene are present.
  • The samples are already separated by isotypes, thus we don't really need C gene sequence, as we rely on a AbHelix protocol.

Upstream analysis

MiXCR has a dedicated preset for this protocol, thus analysing the data ia as easy as:

mixcr analyze abhelix-human-bcr-cdr3 \
    raw/SRR8365277_HIP1_female_IgG1_R1.fastq.gz \
    raw/SRR8365277_HIP1_female_IgG1_R2.fastq.gz \
    results/SRR8365277_HIP1_female_IgG1

One might also use GNU Parallel to process all samples at once:

#!/usr/bin/env bash

mkdir -p results

ls /raw/*R1* |
    parallel -j 2 --line-buffer \
    "mixcr analyze abhelix-human-bcr-cdr3 \
    {} \
    {=s:R1:R2:=} \
    {=s:.*/:results/:;s:_R.*::=}"

Under the hood pipeline:

Under the hood the command above actually executes the following pipeline:

align

Alignment of raw sequencing reads against reference database of V-, D-, J- and C- gene segments.

mixcr align \
    --species hsa \
    -p kAligner2_4.0 \
    -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \
    -OvParameters.parameters.floatingLeftBound=false \
    -OjParameters.parameters.floatingRightBound=true \
    --report results/SRR8365277_HIP1_female_IgG1.report \
    --json-report results/SRR8365277_HIP1_female_IgG1.json \
     raw/SRR8365277_HIP1_female_IgG1_R1.fastq.gz \
     raw/SRR8365277_HIP1_female_IgG1_R2.fastq.gz \
     results/SRR8365277_HIP1_female_IgG1.vdjca

Option --report is specified here explicitly.

--species hsa
determines the organism species.
-p
kAligner2_4.0 a preset of MiXCr parameters which includes kAligner2 (a specialized aligner for BCR data).
-OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP"
Sets a V gene feature to align. Check gene features for more info.
-OvParameters.parameters.floatingLeftBound=false
Results in a global alignment algorithm for V gene left bound. We use it because we don't have any primers covering V gene coding sequence.
-OjParameters.parameters.floatingRightBound=true
Results in a local alignment algorithm for J gene right bound. Local alignment is needed because, as have been mentioned above, the primers are most likely cover the right bound of th J gene, at least for IgG samples. The more correct way would be to use separate settings for IgA\IgM libraries, where most likely the primer most likely only covers the C gene. But for the purpose of this tutorial we will use a more universal way, since the exact location of the primers is unknown.

assemble

Assembles alignments into clonotypes and applies several layers of errors correction(ex. quality-dependent correction for sequencing errors, PCR-error correction by clustering). Check mixcr assemble for more information.

mixcr assemble \
    -OassemblingFeatures="CDR3" \
    -OseparateByJ=true \
    -OseparateByV=true \
    --report results/SRR8365277_HIP1_female_IgG1.report \
    --json-report results/SRR8365277_HIP1_female_IgG1.json \
    results/SRR8365277_HIP1_female_IgG1.vdjca \
    results/SRR8365277_HIP1_female_IgG1.clns

Options --report and --json-report are specified here explicitly so that the report files will be appended with assembly report.

-OassemblingFeatures={FR1Begin:FR4End}
This is a very important parameter that sets the gene features that will define different clones. By default, only CDR3 is used for naming different clones. But in case of BCR data, due to hypermutations in V region, we should also include V gene sequence, because two different clones may share the same CDR3. Note, that this is only possible if sequencing reads cover assembling features, which is true in this case.

export

Exports clonotypes from .clns file into human-readable tables.

mixcr exportClones \
    -c IGH \
    results/SRR8365277_HIP1_female_IgG1.clns \
    results/SRR8365277_HIP1_female_IgG1.clonotypes.IGH.txt
-с <chain>
defines a specific chain to be exported.

By the end of upstream analysis you should have the following set of output files:

# human-readable reports 
SRR8365277_HIP1_female_IgG1.report

# raw alignments (highly compressed binary file)
SRR8365277_HIP1_female_IgG1.vdjca

# IGH, IGK and IGL clonotypes (highly compressed binary file)
SRR8365277_HIP1_female_IgG1.clns

# IGH, IGK and IGL clonotypes exported in tab-delimited txt
SRR8365277_HIP1_female_IgG1.clonotypes.IGH.txt

While .clns file holds all data and is used for downstream analysis, the output .txt clonotype table will contain exhaustive information about each clonotype as well:

See first 100 records from SRR8365277_HIP1_female_IgG1:
cloneId cloneCount cloneFraction targetSequences targetQualities allVHitsWithScore allDHitsWithScore allJHitsWithScore allCHitsWithScore allVAlignments allDAlignments allJAlignments allCAlignments nSeqFR1 minQualFR1 nSeqCDR1 minQualCDR1 nSeqFR2 minQualFR2 nSeqCDR2 minQualCDR2 nSeqFR3 minQualFR3 nSeqCDR3 minQualCDR3 nSeqFR4 minQualFR4 aaSeqFR1 aaSeqCDR1 aaSeqFR2 aaSeqCDR2 aaSeqFR3 aaSeqCDR3 aaSeqFR4 refPoints
0 1252 0.0210544 CAGGTGCAGGTGGTACAGTCTGGTGTTGAAGTGAGGAGGCCTGGGTCCTCGGTGAAAGTCTCCTGCAAGGCGTCTGGAGACACATTCAAGAACTGTGTTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGGGGAATCATCCCTCTCTTTGGTACAACTGACTTTGCCCAGAGGTTCCAGGGCAGACTCACAATTACGACGGACGAGTCTACGACCACAGCCTACATGGAACTGAGTAGGCTGAGATCTGAGGACACGGCCACGTACTACTGTGCGGCGGAACTGGGCTTCGGGAAATTATCTGTCGTCTGGGGCCAGGGGACCACGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(1997.9) IGHD7-2700(35),IGHD1-1400(30),IGHD1-7*00(30) IGHJ6*00(322) nan 57 348 373 0 291 SC66GSG71ASG80TSC82TSG86ASA91GSA94GSG113AST128GSG136ASC140ASG145ASC146GSG148ASA151GSC154TSG188CSA203GSG206ASA216CSG228ASA230TSA231GSA235TSC236TSA239CSA244GSG258CSG263ASC269GSG270ASA278GSC281TSG286CSG302ASC308TSC311GSG333AST334CST338C 1750.0 13 20 33 295 302 35.0;25 31 51 292 298 30.0;22 28 51 295 301 30.0
1 840 0.014126 CAGGTACAGCTACAGCAGTGGGGCGCAGGACCGTTGAGGCCTTTGGAGACCCTCTCCCTCACCTGCGGTGTATCTGGTGGGTCTTTCAGTGGCTATTACTGGGCCTGGATCCGCCAGTCCCCAGGGAAGGGGCTGGAGTGGATTGGCGAAATCAATGATCGCGGATCCATCAACTACAACCCGTCCCTGAAGAGTCGAGTCAGTATCTCAGTTGACACGTCGAAGAATCACTACTCCCTGAATCTGAGGTCTGTGACCGCCGCGGACACGGCTGTATATTACTGCGCGAGAGAGAGTCACGATATTTTGACTGGGCCCCCTTGGGTCTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTGTCGTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV4-34*00(2413.5) IGHD3-9*00(80) IGHJ2*00(442) nan 57 349 370 0 292 SG62AST88CSA94GSC100TSG110CSC124GSC128ASA130CSC140TST149CSC152TSA159GSG160CSC174TSG203CSC213GSA216CST218CSA222TSG223CSC226TSC245GSC259GSC260TSA263CSA269TSC278GSC284TSG287CST289ASG299TSC305GSG332AST341C 1934.0 36 52 93 298 314 80.0 23 73 73 326 376 SC65GSC68G 442.0 nan CAGGTACAGCTACAGCAGTGGGGCGCAGGACCGTTGAGGCCTTTGGAGACCCTCTCCCTCACCTGCGGTGTATCT 40 GGTGGGTCTTTCAGTGGCTATTAC 40
2 793 0.0133356 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAACAACCATGCTATCAACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATTTTTGGCACATCGAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCGACCAGAACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTATATTACTGTGTGAGAGGAAAAATGAGGGAGATGGCTACAATTTTGAGGGACAAGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2857.5) IGHD5-24*00(75) IGHJ5*00(481) nan 57 352 373 0 295 SG145ASG148AST150CSG160ASC218TST224CSG228TSA230GSC281GSG284CSC287ASG335ASC346T 2573.0 23 38 60 306 321 75.0 20 71 71 328 379 SC24G 481.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCAACAACCATGCT 40
3 746 0.0125452 CAGGCGCAGGTGGTTCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTGAAGCTCTCCTGTAAGGCTTCTGAAGGCACATTCAACAGCTATGCCATCGCCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTTACTATAATACACTCAACTACGCACAGAAGTTCCAGGACAGGGTCACAATTACCGCGGACGACTCCACGAACACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGACGACACGGCCGTCTATTTCTGTGCGAGTGGGGCCAGCCGCTGGTACCCCTACTTCTTTGACTCCTGGGCCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2372.5) IGHD6-1300(51),IGHD2-200(46) IGHJ4*00(403) nan 57 350 373 0 293 ST61CSC66GSG71TSA91GSG114CSC122TSG133ASC140ASG145AST155CSA159GSG160CSA216TST217AST220ASG222ASG223ASG228CSC229TSA230CSG253ASA257GSG263ASA278CSG286ASC292TSG323CSG335CSA340T 2089.0 29 42 63 299 312 SA33C 51.0;5 17 93 300 312 SA8C 46.0 19 68 68 315 364 SA23TSA32CSG38C
4 650 0.0109308 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTCAGACTCTCCTGTGAAGCCTCTGGATTCACCTTCAGAAACTACGACATGCACTGGGTCCGCCAAGGTACAGGAAAAGGTCTGGAGTGGGTCTCAGGAATTAGTGCTGCTGGCGACCCAGACTATGCAGACTCCGTGGAGGGCCGATTCACCATCTCCAGAGAGAATGCCCAGAACTCCTTCTTTCTGCAAATGAACAGCCTTAGAGTCGGCGACACGGCTGTCTATTACTGTGCCAGAACTGACAGAGACTTCTACGGTCTGGACGTCTGGGGCCAAGGGACCACGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-13*00(2279.3) nan IGHJ6*00(453) nan 57 348 370 0 291 SG110CSC124AST146ASG148ASC175GSC205GST206ASG210ASA213GST221CSA225CST228GSC234GSG238ASA246GSA272GSA279CSG290CSA292TST296GSG311TSC316TSG320CSG332CSA344C 2185.0 nan 29 83 83 301 355 SA32TSA40CSC71T 453.0 nan GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTCAGACTCTCCTGTGAAGCCTCT 40 GGATTCACCTTCAGAAACTACGAC 40 ATGCACTGGGTCCGCCAAGGTACAGGAAAAGGTCTGGAGTGGGTCTCAGGA 40 ATTAGTGCTGCTGGCGACCCA 40 GACTATGCAGACTCCGTGGAGGGCCGATTCACCATCTCCAGAGAGAATGCCCAGAACTCCTTCTTTCTGCAAATGAACAGCCTTAGAGTCGGCGACACGGCTGTCTATTAC 40
5 580 0.00975364 CAGGTTCACCTGGTGCAGTCTGGAGTTGAGGTGAAGACTCCTGGGGCCTCAGTGAAGGTCTCCTGCCAGGCTTCTGGTTACACCTTTTTCACCTATGATATTAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATTAGTACCTACAGTGGTGACACAAAGTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGACTACAGCCTACCTGGAACTGAGGAGCCTGAGATCTGACGACACGGCCGTATATTACTGTGCGAGACATCACGGTCCTACGACATCAGAGAATTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2530.7) IGHD2-200(32),IGHD5-1200(30),IGHD5-18*00(30) IGHJ5*00(461) nan 57 355 373 0 298 SG65CSC82TSA94CSG95TSA123CSA144TSC145TSG148CSG154ASC158TSC209TSC212TSG213AST215CSA220GSA225GSC233GSC246TSG286CSC287TSA297CSG302ASG335ASG351C 2284.0 12 24 93 300 312 SA15CST20G 32.0;36 42 69 304 310 30.0;36 42 69 304 310 30.0
6 511 0.00859329 CAGGTCCAACTTGTCCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGGCCTCAGTGAACATTTCCTGCAGGGCTTCTGGATTCAGCTTCAGTGACAATCTTATAAATTGGGTGCGCCAAGCCCCCGGACAAAGCCTTGAGTGGATGGGCTGGATTAACCCTGACAATGGAAACACAAGATATTCACAGACGTTCCAGGGCAGAGTCACCATTTCCAGGCACTCATCCGCGAGCATAGCCTACGTGGAGGTGAGCGACCTGACATCTGAAGACACGGCTGTCTATTACTGTGCGAGAGACATACTGTCCGTCGGCCCGCGTGCGAATGATGCTTTTGATGTCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(2151) IGHD4-1100(30),IGHD4-400(30),IGHD5-5*00(28) IGHJ3*00(481) nan 57 353 373 0 296 SG65ASG71CSA91GSG113CSG114ASA124GSA136TSC139GSC145GSA147GSG148AST150ASG153CSC154TSG158ASC159ASG173ASG188CSA203CSC209TSG213CSG217AST224ASA232GSA244CSA267TSG273CSA276TSC289TSA297GSC303GSA309GSG310ASG316CSG335C 1945.0 5 11 48 298 304 30.0;5 11 48 298 304 30.0;5 14 60 296 304 DG9 28.0
7 460 0.00773564 GAGGTTCAGCTGCTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCGCCTGTGCAGCCTCTGGATTCTCCTTTAATTCCTATGCCATGGTCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTAGTGCTAGAGGCGGGAGTTCATACTTCGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGAATGTGCTGTCTCTGGAAATGAACAACCTGAGAGCCGAGGACACGGCCACATATTTCTGTGCGAAAGGTTCTATCGAATATAGTGCCTCGGTTGACCACTGGGGCCAGGGAACCCTGGTCCTCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-23*00(2218.1) IGHD5-18*00(51) IGHJ4*00(333) nan 57 352 373 0 295 SG62TST69CSG74AST117GSA138TSG145ASC146TSA147TSG148CSA159GSG160TSC205TSG214CST218AST221CST224GSC227TSA228TSA235TSG257CSC287TSA288GSC289TSA295CSC300GSG310ASG333AST334CSA340T 2109.0 25 38 69 303 316 SG35C 51.0 26 68 68 319 361 ST31CSA55CSC56T 333.0 nan GAGGTTCAGCTGCTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCGCCTGTGCAGCCTCT 40 GGATTCTCCTTTAATTCCTATGCC 40
8 417 0.00701253 CAGGTGCCGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGACGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATACACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATGTATGGCCCAGCAAAGTACGCACAGAGGTTCCAGGGCAGAGTCACGATCACCGCGGACGAATCCACGACCACTGTCTACATGGAGCTGACCAGCCTGACATCTCAAGACACGGCCGTCTATTACTGTGCGAGAGTTACCTCTATGGTTCGGGGAGTCATCGACAACTGGTTCGACCCCTGGGGCCACGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2641.7) IGHD3-10*00(67) IGHJ5*00(481) nan 57 352 373 0 295 SA64CSA112CSC158ASA159CSG160ASC218GST220AST224CSA225CSC233GSA244GST266CSG286CSA290TSC292TSG307CSG316CSG321CSG323ASG335C 2370.0 37 56 93 301 320 SA46GST53C 67.0 20 71 71 322 373 SG45C 481.0 nan CAGGTGCCGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGACGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCAGCAGCTATGCT 40
9 380 0.00639031 CAGGTTCACCTGGTGCAGTCTGGAGTTGAGGTGAAGACTCCTGGGGCCTCAGTGAAGGTCTCCTGCCAGGCTTCTGGTTACACCTTTTTCACCTATGATATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATTAGTACCTACAGTGGTGACACAAAGTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGACTACAGCCTACCTGGAACTGAGGAGCCTGAGATCTGACGACACGGCCGTATATTACTGTGCGAGACATCACGGTCCTACGACATCAGAGAATTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2561) IGHD2-200(32),IGHD5-1200(30),IGHD5-18*00(30) IGHJ5*00(461) nan 57 355 373 0 298 SG65CSC82TSA94CSG95TSA123CSA144TSC145TSG148CSG154ASC209TSC212TSG213AST215CSA220GSA225GSC233GSC246TSG286CSC287TSA297CSG302ASG335ASG351C 2313.0 12 24 93 300 312 SA15CST20G 32.0;36 42 69 304 310 30.0;36 42 69 304 310 30.0
10 365 0.00613806 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAAGTGAGGGAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACAGCTTCACCAGTCTTGACATCAACTGGGTGCGACAGACCGCTGGACAAGGGCTTGAGTGGATGGGATGGATGCAACCTAGTACTGGGAGGACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACCTCCATAAACACAGCCTACATGGAGCTGACTACCCTAACATCTGATGACACGGCCTTTTATTACTGTGCGCGAGGCGTCAGTGCGGGAGTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-8*00(2451.1) IGHD3-1600(26),IGHD1-2600(25),IGHD3-10*00(25) IGHJ4*00(420) nan 57 357 373 0 300 SG86ASA91GSA93GSC139GST150CSA151TST155CSG174ASA177GSA210CSC212ASA217GSC218TSG220CST224GSA226GSC227GSA273GSG286ASG307CSC308TSG310CSG314ASG316CSG323TSG333TSG335TSA348CSC354G 2159.0 53 61 111 302 310 SG55C 26.0;28 33 60 305 310 25.0;47 52 93 305 310 25.0
11 362 0.00608761 CAGGTCCAGCTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGATACACCTTCACTAGATATACTATGAACTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACCCTGACAATGGTAACACAAAATCTTCACAGAAGTTCCAGGACAGAGTCATCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGACCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGGTATTGCAACAGGCCAGCTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(2844.1) IGHD6-1300(32),IGHD2-800(29) IGHJ5*00(420) nan 57 352 373 0 295 SG114ASC149ASG153ASC159AST161CSG213CSG217ASA235CSG253ASC262TSG302C 2631.0 23 35 63 295 307 SA27TSG31A 32.0;1 13 93 295 306 SA5TDT9 29.0 29 71 71 313 355
12 323 0.00543177 GAGGTTCATCTGTTGGAGTCTGGGGGAGACTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTACAGCCTCTGGACTCACCTTTAGCACCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTAGAGTGGGTCTCAGCTATTGGTGGTAGTGGTACTGGTGGTCGCACATATTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGGTGTATCTGCAAATGAACAGTTTGAGAGCCGACGACACGGCCGTATATTACTGTGCGAAGTCGCCTGGGGGTCTAGATGGCTACAATTCCGACTACTACGGAATGGACGTCTGGGGCCAAGGGACCACGGTGACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-23*00(2515.8) IGHD5-24*00(71) IGHJ6*00(482) nan 57 350 373 0 299 SG62TSG65TSG85ASG123AST135CSG148CSG191ASA210GI222AI222CI222TI222GI222GI222TSA225CSC233TSC291GSC311TSC312TSG323C 2407.0 24 41 60 314 331 SA38C 71.0 29 83 83 331 385 ST39ASC69G 482.0 nan GAGGTTCATCTGTTGGAGTCTGGGGGAGACTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTACAGCCTCT 40 GGACTCACCTTTAGCACCTATGCC 40
13 315 0.00529723 CAGGTGCAGCTGGTGCAGTCTGGGGCTGCGGTGAGGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCACTAAATATGCTATCACCTGGGTGCGACAGGCCCCTAGACAAGGGCTTGAGTGGATGGGAGGGATCGTCCCTCTTCCTGGTACAACAAACTACGCACAGAAGTTCCGGGGCAGAGTCACCATTAGCGCGGACGAATCTACGAGCACAGCCTACTTGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGCGGAGTCGGGGGCCTAGGCGGAAGTAGTGGCTGGCCCGATTATGCTTTTGATGTCTGGGGCCAAGGGACTATGGTCATCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2643) IGHD6-1900(46),IGHD3-2200(40),IGHD5-12*00(40) IGHJ3*00(394) nan 57 350 373 0 293 SA85CSA91GSG145CSC146TSG148ASC149ASG160CSG180ASA210GSA216CSC218TST219CST220CSG228ASA250GSG263CSC268GSC281TSA297T 2379.0 27 39 63 315 327 SC29T 46.0;44 52 93 315 323 40.0;30 38 69 317 325 40.0
14 296 0.00497772 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCAGCTTCAGCAACTTTGTAATCAGTTGGGTGCGACAGGCCCCTGGACAGGGGCTTGAGTGGATGGGAGGGATCATCCCAAACTTTGGTACAACAAACTACGCACAGAAGTTCCAGGGCAAAGTCACGATTACCGCGGACGAAACTACGAGAACAGCCTACCTGGAGCTGAGTGGCCTGACATCTGAGGACACGTCCGTCTATTACTGTGCGAGAGATGTCGGGGGAGAGGCTACAATTCGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2644.2) IGHD5-24*00(58) IGHJ4*00(380) nan 57 357 373 0 300 SG86ASC139GSG148ASA151TSC154TST155ASC161TSA185GST215AST217ASG228ASG256AST279ASC281TSC287ASA297CSC308TSA309GSG316CSG330TSG335CSC354G 2362.0 23 38 60 304 318 DT27 58.0 30 68 68 320 358 380.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCAGCTTCAGCAACTTTGTA 40
15 292 0.00491045 CAGGTTCACCTGGTGCAGTCTGGAGTTGAGGTGAAGACTCCTGGGGCCTCAGTGAAGGTCTCCTGCCAGGCTTCTGGTTACACCTTTTTCACCTATGATATCAGTTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATTAGTACCTACAGTGGTGACACAAAGTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACTTCCACGACTACAGCCTACCTGGAACTGAGGAGCCTGAGATCTGACGACACGGCCGTATATTACTGTGCGAGACATCACGGTCCTACGACATCAGAGAATTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2492.7) IGHD2-200(32),IGHD5-1200(30),IGHD5-18*00(30) IGHJ5*00(461) nan 57 355 373 0 298 SG65CSC82TSA94CSG95TSA123CSA144TSC145TSG148CSG154ASC161TSC209TSC212TSG213AST215CSA220GSA225GSC233GSC246TSA278TSG286CSC287TSA297CSG302ASG335ASG351C 2255.0 12 24 93 300 312 SA15CST20G 32.0;36 42 69 304 310 30.0;36 42 69 304 310 30.0
16 291 0.00489363 CAGGTGCACCTGGTGCAGTCTGGGACTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGTTCTGGTTTCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATGATCGTCCCCAGTCTTGACACAACAAACTACGCACAGAAGTTCCAGGCCAGAGTCACGATTACCGCGGACGAGGTCACGAGCACAGCCTACATGGAGTTGCGCAGCCTGAGATCTGAGGACACGGCCGTATATTATTGTGCGAGATGGCCACAGCCTCGGTATACTGCTGACCCTTACGCTGTGGACGTCTGGGGCCAAGGGACCAGGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2567.8) IGHD1-2000(38),IGHD1-700(38),IGHD1-26*00(36) IGHJ6*00(374) nan 57 351 373 0 294 SG65CSG81ASC149TSA151CSC154GSA156TSG204ASG205TSA210GST215CST217GSC218TST219CSG223AST224CSG228ASG253CSA278GST279GSC280TSC303TSA306CSG335ASC341T 2244.0 16 27 51 306 316 DA22 38.0;16 27 51 306 316 DA22 38.0;19 29 60 306 316 SG26C 36.0
17 274 0.00460775 CAGGTCCAACTTGTCCAGTCTGGGGCTGAGCTGAAGAAGCCTGGGGCCTCAGTGAACATTTCCTGTACGGCTTCTGGATTCACCTTCAGTGACAATCTTATAAATTGGGTGCGCCAAGCCCCCGGACAAGGGCTTGAGTGGATGGGATGGCTCAACCCTGACACTGGAAATACAAGATATTCAGAGACGTTCCAGGGCAGAGTCACCATTTCCAGGCACTCATCCGCGAGCATAGCCTACTTGGAACTCAGCGACCTGGAAAATGAAGACACGGCTCTCTATTTCTGTGCGAGAGACAGGCACAGCGTCGGCCCGCGGGCGAATGATGCTTTTGATGTCTGGGGCCAAGGGACCATGATCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(1924.9) IGHD2-200(26),IGHD5-500(25),IGHD6-25*00(25) IGHJ3*00(423) nan 57 353 373 0 296 SG65ASG71CSG87CSG113CSG114ASC122TSA124CSA136TSC145GSA147GSG148AST150ASG153CSC154TSG158ASC159ASG173ASA186GSA207CSG213CSG217ASA220CST224ASC227TSA232GSC240GSA244CSA267TSG273CSA276TSC289TSA297TSG302ASG305CSA309GSG310ASA315GSG316AST318ASC319ASG333CSG335CSA340T 1713.0 0 8 93 298 306 ST4C 26.0;26 31 60 301 306 25.0;26 31 54 302 307 25.0
18 264 0.00443959 CAGGTGCAGGTGGTGCAATCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAACTATGCTATCAGCTGGGTGCGGCAGGCCCCTGGACATGGACTTGAGTGGGTGGGAGGGATCATCCCTCTGACTGAAACACCAGTCTACGCACAGACGGTCCAGGGCAGACTCACCATTACCGCGGACGAAATCACGAGTGCGGCCTACATGGAGCTGAGCAGCCTGAGATCTGACGACACGGCCGTTTATTATTGTGCGATTGGCACCAGGAACAGCTGGACTTGTGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2385.8) IGHD2-200(38),IGHD1-100(35),IGHD6-13*00(35) IGHJ4*00(381) nan 57 349 373 0 292 SC66GSG74ASG148ASA170GSA185TSG188ASA198GSA216CSC218GST219AST220CSG223AST224ASG228CSA231GSA232TSA244CST246GSG258CSG263CST279ASC280TSC287TSA288GSA290GSG323CSG335TSC341T 2108.0 7 18 93 305 315 DT14 38.0;14 29 51 297 313 I17AST19ASA23G 35.0;32 39 63 305 312 35.0
19 247 0.0041537 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCGTCTGGATACAGCTTCACCCGTCATGATATCAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATTAACCCTAGCAGTGGTAACACAGGGTATGCACAGAGGTTTCTGGGCAGACTCACCATGACGACCGACACCTCCACAAGTACAGCCTATATGGAGCTGAGCGGCCTGAAATCTGAGGACACGGCCATATATTACTGTGCGAGAGAGGGCATTCTGTTTTCTGGAGTGATTGTCTTCTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCCCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-8*00(2517.6) IGHD3-3*00(44) IGHJ6*00(472) nan 57 352 373 0 295 ST128GSC139GSA147CST150CSC161TSA177CSG209TSA217GSC233GSA244GSC248TSA250TSG258CSC269GSG271CSG272CSA273GST283CSC287TSC296TSA309GSG316ASG333ASG335A 2254.0 40 54 93 306 321 I44CSG51A 44.0 30 83 83 323 376 SA32TST76C 472.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCGTCT 40 GGATACAGCTTCACCCGTCATGAT 40
20 246 0.00413689 CAGGTGCAGCTGGTGCAGTCTGGGACTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAAGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGTAGTTCTGGTTTCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATGATCGTCCCCAGCCTTGACACAACAAAGTACGCACAGAAGTTCCAGGCCAGAGTCACGATTACCGCGGACCAGTTCACGAGCACAGCCTACATGGAGTTGAGCAGCCTGAGATCTGAGGACACGGCCGTATATTATTGTGCGAGATGGCCACAGCCTCGGGGTACTGCTGACCCTTACGCTGTGGACGTCTGGGGCCAAGGGACCAGGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2533.6) IGHD2-1500(33),IGHD2-200(31),IGHD2-8*00(31) IGHJ6*00(374) nan 57 351 373 0 294 SG81ASG113ASC146TSC149TSA151CSC154GSA156TSG204ASG205TSA210GST215CST217GST219CSG223AST224CSG228ASC233GSG253CSG276CSA278GSC280TSC303TSG335ASC341T 2244.0 47 57 93 309 318 DG51 33.0;12 21 93 309 318 SA18G 31.0;39 48 93 310 319 SG45C 31.0
21 246 0.00413689 CAGGTGCAGGTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGTCCTCGGTGAAGATCTCCTGTAAGGCCTCTGGACGCATCTTCAGCAGTTTCCCCACTTCCTGGGTGCGACAGGTCCCTGGACAAGGGCTTGAGTGGATGGGAGGGGTCATCAGTGCCTCTGGCTCAGTCACATATGCACCGAAGTTCCAGGGCAGAGTCACGATGACCGCGGTCAATTCCGCGGGCATAGGCTATATGGAGTTGACTAGCCTGACCTCTGAGGACACGGCCATCTATTACTGTGCGAGAGTGGGAAGTAGAGATGCCTACAACTATGTCCTTGATCAGTGGGGCCCGGGGACCATGGTCACCGTCTCGTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(1806) IGHD5-24*00(68) IGHJ3*00(147.7) nan 57 352 373 0 295 SC66GSG86ASG114ASC122TST128CSG135CSC139TSC149TSA151TST152CSG153CST155CST157CSC158TSA159TSG160CSC175TSA207GSC213ASC214GSA216GST217CST220CST224CSA225TSC229TSA230CSA232CSC233ASC236TSA241CST266GSA274TSG276ASA278TSA282GSA285GSC289TSC292GSC296TSC303TSG307CSC308TSG316CSA317CSG333ASG335C 1587.0 20 42 60 301 323 SG29CST36CSC39T 68.0 36 70 70 333 367 SA43CSA44GSA50CST65G 224.0 nan CAGGTGCAGGTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGTCCTCGGTGAAGATCTCCTGTAAGGCCTCT 40 GGACGCATCTTCAGCAGTTTCCCC 40
22 245 0.00412007 CAGGTCCAACTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCACGGCATCTGGATACACCTTCACTCACTATGCTATTCATTGGGTGCGCCACGCCCCCGGACAAAGGCTTGAGTGGATGGGATTCATCAACGCTGGCAGTGGTAACACAAAATATTCACAGACTTTTCAGGGAAGACTCACATTTACCAAAGACACATCCGCGAGCACAGCCTACATGGACCTGAGCAGCCTGAGATCTGAAGACACGGCTATATATTACTGTGCAAGAGGCTTAGCAGCAGATGGTGCCTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(2495.8) IGHD6-13*00(56) IGHJ5*00(331) nan 57 352 373 0 295 SG65ASA124CST128ASA147CSG148ASG158TSG173CSG205TSG206CSA220GSA244CSG245TSC248TSC254ASG258CSC263ASA264TSG271ASG272ASG302CSG333ASG335ASG347A 2283.0 26 40 63 298 312 SC35A 56.0 35 71 71 313 349 SC51G 331.0 nan CAGGTCCAACTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCACGGCATCT 40 GGATACACCTTCACTCACTATGCT 40
23 245 0.00412007 CAGGTGCAGTTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTCACTATGGCATCCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGTTGGCAGTTATTTCATATGATGGAAGTAATAAACACTATGCAGACTCCGTGAAGGGCCGATTCACCGTCTCCAGAGACAATTCCAAGAACACGCTGTACCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTCTATTTCTGTGCGAGATATAGTGGGAAGTACCAGGGTCCCATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-30*00(2688.3) IGHD1-2600(50),IGHD5-1200(50),IGHD5-18*00(45) IGHJ4*00(420) nan 57 349 373 0 292 SC66TSA147CSG148ASG158CSG198TSA209TST231CSA264GST296CSG335CSA340T 2601.0 22 32 60 294 304 50.0;26 36 69 292 302 50.0;27 36 69 293 302 45.0
24 230 0.00386782 GAGGTTCAGCTGCTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCGCCTGTGCAGCCTCTGGATTCTCCTTTAATTCCTATGCCATGGTCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTAGTGCCAGAGGCGGGAGTTCATACTTCGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGAATGTGCTGTCTCTGGAAATGAACAACCTGAGAGCCGAGGACACGGCCACATATTTCTGTGCGAAAGGTTCTATCGAATATAGTGCCTCGGTTGACCGCTGGGGCCAGGGAACCCTGGTCCTCGTCTCGTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-23*00(2187.3) IGHD5-18*00(51) IGHJ5*00(284) nan 57 352 373 0 295 SG62TST69CSG74AST117GSA138TSG145ASC146TSA147TSG148CSA159GSG160TSC205TSG214CST215CST218AST221CST224GSC227TSA228TSA235TSG257CSC287TSA288GSC289TSA295CSC300GSG310ASG333AST334CSA340T 2080.0 25 38 69 303 316 SG35C 51.0 31 71 71 321 361 SC35GSA58CSC59TSC66G 284.0 nan GAGGTTCAGCTGCTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCGCCTGTGCAGCCTCT 40 GGATTCTCCTTTAATTCCTATGCC 40
25 229 0.003851 CAGGTGCAACTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAACAGATATGCTATCAGCTGGGTGCGACAGGCCCCAGGACAAGGGCTTGAGTGGATGGGAGGAATCATCCCTATATTTGGGATAGGAAACGACGCACAGAGGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGGGCACAGCGTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGGCGTGTATTACTGTGCGAGATCGGCTATTACGCTTTTTGGAGTGGTTTCTATTCCTCCACACTACTACTCTGAAATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2822.5) IGHD3-3*00(96) IGHJ6*00(454) nan 57 351 373 0 294 SG65ASG145ASC149AST179ASG206ASC218AST224GSC226TSC229GST234GSA244GSA285GSC293GSG323ASC331G 2505.0 32 54 93 299 321 SA39C 96.0 26 83 83 334 391 SA35CSC36TSG38AST39A 454.0 nan CAGGTGCAACTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCAACAGATATGCT 40
26 228 0.00383419 CAGGTGTACCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGATCTCCTGCAAGGCCTCTGGAGGCATCTTCAGCAGCAATACTATCAACTGGGTGCGACAGGCCGCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCCCTCTTTGGAACAGCAAACTATGCAGAGAAGTTCCAGGGCAGAGTCACCATTACCGCGGACAAATCCACGAAGACAGAGTATATGGAGTTGACGAGCCTGAGATCTGAGGACACGGCCGTCTATTACTGTGCGAGCAAAGCAGCTTGTGGTGGTGACTGCTATGCCTTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2484) IGHD2-21*00(83) IGHJ4*00(382) nan 57 350 373 0 293 SC63TSG65CSG114AST128CSC139TST150ASG153ASG160ASC177GST215CSA216CST224ASC236TSC240GSG263CSG276ASG286ASC287GSC292ASC293GSC296TSC303TSG307CSC308GSG335C 2205.0 28 53 84 296 321 ST32GSA33CST46C 83.0 24 68 68 323 367 SA32CSC63G 382.0 nan CAGGTGTACCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGATCTCCTGCAAGGCCTCT 40 GGAGGCATCTTCAGCAGCAATACT 40
27 225 0.00378374 CAGGTGCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCAGCTCTGGTATGAGCTGGGTGCGGCAGGCCCCTGGACAAGGACTTGAGTGGATGGGATGGATCAGTGCACACACTGGTAGCTCAGAGTATGCACAGAGGTTCCAGGGCAGAGTCACCATGACCACAGACAGATCCACGAGCACTGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTTTATTACTGTGCGAGAGCGTTCTTCTATCAGGGTAGTGATAGTCGTGGTTATTCCTTTGATGCTTTTGATTTCTGGGGCCCAGGGACACTGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2861.7) IGHD3-22*00(72) IGHJ3*00(413) nan 57 352 373 0 295 ST62GSA151CSC158GSA170GSG188ASC212TST215AST216CSA220CSA226GSA228TSA231GSC233GSA244GSC246TSC277GSA290TSG335T 2428.0 40 60 93 314 334 SA47CSA57C 72.0 20 70 70 335 385 SA33TSA43CSA51C 413.0 nan CAGGTGCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCT 40 GGTTACACCTTTACCAGCTCTGGT 40
28 218 0.00366602 CAGGTTCAGTTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGACGGTCTCCTGCAAGACTTCTGGCTACACCTTTAGCAACTATGGAATCAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGTTGGATCAGCGGTTACAATGGCAACACAAATTATGCACAGACCGTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGGGCACAGTATACATGGAGCTGAGGAGCCTGAAATCTGACGACACGGCCATATACTATTGTTCGAGGTTTATTATGGTCGGTGGCTGGTTCGACCCGAACTACTATCACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2583.3) IGHD6-19*00(49) IGHJ6*00(512) nan 57 350 373 0 293 SC66TSA112CSG126AST134CSC145GSG148AST155ASG160ASC161TSA203TSC214GST224CSC233TSA244CSG245CSC246GSA285GSC292TSC293ASG316ASG333ASG335AST338CSC341TSG345T 2205.0 31 47 63 307 322 SA40TDT43 49.0 26 83 83 325 382 SC33TST34C 512.0 nan CAGGTTCAGTTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGACGGTCTCCTGCAAGACTTCT 40 GGCTACACCTTTAGCAACTATGGA 40
29 210 0.00353149 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGATGCAGCAGCCTGGGGCCTCGGTGAGGGTCTCCTGCAAGGCGTCTGGAGGCACCTTCAGCAAATATGCTTTCAGTTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGCTCGGAGGGACCATCCCTATGTTTGGAACACCAAACTACGCACAGAAGTTCCAGGGCAGAGTCGCCATCTCCGCGGACGAATCGACGGCTACAGTCTACATGGAGTTGAGCAGCCTGAGATCTGAGGACACGGCCGTCTATTTCTGTGCGAGACCACTACGTGATAGAAACTACTACTACGGTATGGCCGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2357.2) IGHD1-700(35),IGHD2-1500(35),IGHD3-22*00(35) IGHJ6*00(541) nan 57 351 373 0 294 SG87ASA90CSA93CST102GSA112GST128GSG148ASC149ASA156TSC161TSA198CSG200CST208CSC218GST224ASG228CSA261GSG263CST266CSA267TSC281GSA285GSG286CSC287TSC292TSC303TSG335CSA340T 2128.0 29 36 51 296 303 35.0;16 23 93 294 301 35.0;10 17 93 294 301 35.0
30 208 0.00349786 CAGGGGCAGCTGGTGCAGTCCGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTCACCACCTACTACATACACTGGATGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATGTTCAACCCCTACACTGGTGGCACAAGATACGCACATAAGTTCCAGGGCAGAGTCACCATGACCGGGGACACGTCCACGAGCACAGGCTACATGGAGCTGAGTAGGTTGAGATCTGACGACACGGCCGTGTATTATTGTGCGAGACTGTGGGGTGAAATAGGAACCGCGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-46*00(2811.2) IGHD2-2100(38),IGHD5-1800(33) IGHJ5*00(440) nan 57 351 373 0 294 ST61GST77CSG148CST155CSG158ASG165ASA206GSA207TST215CSA216TSG217AST218CSG219ASG220CSA225GSC233ASG242TSA270GST292GSC308TSC311GSC312TSG323CSC341T 2244.0 35 46 84 295 305 DT40 38.0;23 33 69 301 310 DT28 33.0 27 71 71 317 361
31 207 0.00348104 CAGTTTCAACTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGTAAGGCCTCTGGTTACAACTTTACCAGATTTGGTATCAGCTGGGTGCGACAGGCCCCAGGACACGGGCTTGAGTGGATGGGATGGATGGGCGCTCACAGTGGTCACACAAGGCAAGCACAGAAGTTCCAGGGCAGACTCACCATGACCACAGACGCTTCCATGAACACAGCCTATATTGACCTGAGGAGCCTGACATCTGACGACACGGCCCTCTATTACTGTGGGAGAGAGGGGCAGCAACTGGCCCAGGAAGATTACTACCAATTCAACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2291.9) IGHD6-1300(41),IGHD1-100(35) IGHJ6*00(487) nan 57 353 373 0 296 SG60TSG65ASC122TST128CSC139ASC149ASA151TST179ASA185CSC209GSA210GST216CSA220GSA225CSA232GSC233GST234CST236ASC246TSG258CSA276GSA278TSC283TSG286ASC296TSG299TSG302CSG316CSG333CSG335CSC346G 2061.0 28 39 63 299 310 SG34A 41.0;21 28 51 303 310 35.0 14 83 83 313 382 ST16GST19GST28CSC30ASA32TST34ASC71T
32 206 0.00346422 CACGAGCACCTGGTGCAGTCTGGGGCTGAGGTGAAGAGGCCTGGGGCCTCCCTGAAGGTCTCCTGCAAGGCTTCTGGATACAGTTTCACCGGCTACTATATTCATTGGGTGCGACAGGCCCCTGGACAAGGACTTGAGTGGATGGGATGGATCAACCCTGACAGTGGTGCCACAAACTACGCACAGAACTTTCAGGGCAGGGTCACCCTGACCAGCGACACGTCCATCAGCACAGCCTCCATGGACCTGACCAGTCTGACATCTGACGACACGGCCGTCTATTACTGTGCGAGAGGCGACTATGGGACTGGTGGTTATCCTTTTCCTTACTTTGACTATTGGGGCCAGGGAACCCTGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-2*00(2612.3) IGHD2-800(51),IGHD3-2200(44) IGHJ4*00(402) nan 57 352 373 0 295 SG59CST61ASG65CSA94GSA107CSG108CSC139GSC140TSG158TSC161TSG188ASA216GSG226CST236CSG245CST255ASA264CSG272CSA295CSG302CSG307CSG311TSG316CSG335C 2254.0 35 57 93 300 321 ST38GST40GDG50SG54C 51.0;36 56 93 298 318 SA42GST43GSG45CSA47G 44.0 22 68 68 327 373 SC33TSC56T
33 199 0.00334651 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTTAAGGTCTCCTGCACGGCTTCTGGAGGCTCCCTCAGGAACTCTGTTATCAGCTGGGTGCGACAGGCCCCTGCACAAAGACTTGAGTGGATGGGGGGGGTCATCCCTATCCTTGGTACAGCCAACTACGCGCAGAAGTTTCAGGGCAGAGTCACGATGACCGCGGACGAGGCCACCAGTACAGCCTACATGGACTTGAGCAGCCTGAGCCCTGACGACACGGCCGTATATTACTGTGCGAGACTCGGTCACCCTGGCCACTGGGGCCCGGGAACCCTGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2417) IGHD4-17*00(30) IGHJ400(302),IGHJ500(293) nan 57 351 373 0 294 SG110TSA124CSA138TST141CSC146GSG148ASA151CSC154TSG181CSG186ASG188ASA203GSA207GST219CSA230CSA239GSC248TST266GSA278GST279GSG284CSC287TSG302CSC303TSA317CST318CSG323CSG335A 2128.0 3 9 48 298 304 30.0 32 68 68 310 346 SA41CSC56T 302.0;33 71 71 308 346 SC35ASA44CSC59T
34 198 0.00332969 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGGGAGGGGGTCTACGCGGTGACCCCCAAAAACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(3237.3) IGHD3-1600(40),IGHD4-1700(35) IGHJ6*00(480) nan 57 352 373 0 295 2950.0 15 23 111 316 324 40.0;22 29 48 310 317 35.0 35 83 83 325 373
35 196 0.00329606 CAGGTGCAGGTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGCAGCTTTGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGTCTCTTATATGGTATGATGGAAGTAAAAAATCGTATGGAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAGGAATACGGTGTATTTGCAAATGAACAGCCTGAGAGCCGACGACACGGCTGTCTATTACTGTGCGCGAGATGCTTCGTATTACAGTCTTTGGAGTGGTTATTACCCCTCACGCAACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-33*00(2567.3) IGHD3-3*00(98) IGHJ6*00(480) nan 57 354 373 0 297 SC66GST146CSA151TSG201TSA203TSG204CST227ASA232CSC233GSC238GSA283GSC287TSC291GSC297TSG323CSG335CSA348C 2477.0 30 58 93 301 329 SG38ASA39GST41C 98.0 35 83 83 340 388 480.0 nan CAGGTGCAGGTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCT 40 GGATTCACCTTCAGCAGCTTTGGC 40
36 189 0.00317834 CAGCTACAGCTGGTGCAGTCTGGGGCTGAGGTGAGGGAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGTTATACTGTCATCTGGGTGCGACAGGCCCCTGGACAGGGGCTTGAGTGGATGGGAGGGATCACCCCTACATTAAATATAGCTAAGTACGCAGAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAGTCCACGAGCACAGTCAACATGCACCTGAGCAGCCTGAGATCTGAGGACACGGCCGTCTATTTCTGTGCGAGAGGCTACTACAGTGGGAGCAACCCGTCCTCCTTTGACTACTGGGGCCAGGGAACCCTGGTCGCCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2485) IGHD1-2600(47),IGHD2-200(40),IGHD4-11*00(40) IGHJ4*00(413) nan 57 352 373 0 295 SG60CSG62ASA91GSA93GSC149TSG153ASA156GSG160TSA185GST211CST217CSC218AST221ASG222ASG223ASC226TSA230TSC233GSC240GSA278GSC292TST294ASG300CSG302CSG335CSA340T 2196.0 22 37 60 300 315 ST24CST34A 47.0;16 24 93 296 304 40.0;18 26 48 298 306 40.0
37 187 0.00314471 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCGGGAGGCACCTTCAGCAGCTCTGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAATGGATGGGAGCGATCATCCCTGTCTTTGGAACAGCGCACTACGCACAGAAGTTCCAGGGCAGAGTCACCATTACCGCCGACAAACCCACGAGCACAGCCTACATGGAACTGAGCAGGCTCAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGAGCGGCCAGAGAGGGGTAAGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2807.8) IGHD5-2400(25),IGHD6-2500(25) IGHJ6*00(431) nan 57 353 373 0 296 ST131GSA151CSG194ASG205CSA216GST224ASA230GSA231CSG263CSG272CSG276AST279CSG302ASC311GSG314C 2525.0 22 27 60 302 307 25.0;28 33 54 296 301 25.0 37 83 83 309 355 ST41A
38 186 0.00312789 CAGGTGCAGCTGGTGCAGTCTGGGGCTGACGTGAAGAAGCCTGGGTCGTCGGTGAAGGTCTCCTGCAAGACTTCTGGAGGCTCCTTCGGCAGTTCTGCTATCAGCTGGGTGCGACAGGCCCCCGCACAAGGGCTTGAGTGGATGGGAGAGATCATCCCTGTTTTTGATAAAGCGAACTACGCTCAGAACTTCCAGGGCAGACTGACCATTACCGCGGACGAACTCACGGGAACAGTGTTCATGGAATTGAGTAGCCTGAGATCTGAGGACACGGCCGTGTATTTCTGTGCGAGACTAAGGAGGGATTGGGGTGATGCATTTGATCTCTGGGGCCTAGGGACATTCGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2322.8) IGHD3-16*00(30) IGHJ3*00(355) nan 57 351 373 0 294 SG86CSC104GSG126ASA138TSA144GSC149TSA151CST179CSG181CSG205ASA216GSC218TSG223ASC226ASA230GSA239TSG245CSG258CSC260GSG263CST279CSC280TSA285GSC287ASC292TSC293GSA295TSG302ASC303TSC308TSA340T 2041.0 52 58 111 305 311 30.0 20 70 70 311 361 ST26ASA33CSA43TSA51TSG53C 355.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGACGTGAAGAAGCCTGGGTCGTCGGTGAAGGTCTCCTGCAAGACTTCT 40 GGAGGCTCCTTCGGCAGTTCTGCT 40
39 181 0.00304381 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTGACGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAACTATGCAATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGGGGGATCATCCCTATCGTTGGAACAGGAAGTTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAACCCACGACCACAGCCTACATGGAGCTGAGCAGCCTGAGATTTGAGGACACGGCCGTGTATTATTGTGCGAGAGTTGTTATTCTAGTACCAACTGCCTCCACTCACTACTACTACCATATGGACGTCTGGGGCCCAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2828.9) IGHD2-2*00(51) IGHJ6*00(483) nan 57 352 373 0 295 SA91GSA112CSG148AST155ASA203GST219GST224ASC229GSA232GSC233TST279CSG286CSC319TSC341T 2544.0 43 56 93 304 317 SG51A 51.0 26 83 83 325 382 SG37CSG38ASA56C 483.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTGACGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCAGCAACTATGCA 40
40 167 0.00280837 CAGGTTCAGCTGGTGCAATCTGGACCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACTTTTACCAATTATGGTTTCAACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGGCACACAAAGTATTCACAGATATTCCAGGCCAGAGTCATCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGTTGAGGAGCCTGACATCTGACGACACGGCCGTGTATTACTGTGCGAGAGAGGGGGCCGGGACTAACCCACTAGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2696.6) IGHD1-2600(35),IGHD3-2200(33),IGHD5-12*00(30) IGHJ4*00(380) nan 57 353 373 0 296 SG74ASG81CSC140TSG148ASC149TSA156TSG160AST224GSA225CSC233GSG237TSA244TSG245ASC246TSG253CSC262TSC303TSG316C 2438.0 9 16 60 311 318 35.0;7 16 93 308 318 I10C 33.0;10 16 69 312 318 30.0
41 164 0.00275792 CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCATCTACGGTATCTCCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGGTTACAATGGAAACACAGACTATGCACAGAACCTCCAGGACAGAGTCACCCTGACCACAGACGCATCCACGAGCTCAGTATACATGGAGCTGAGGAGCCTCAGATCTGACGACACGGCCGTCTATTACTGTGCGAGGGTCGATTACTATGATAGTAGCGGTTATTACGGATACTGGGGCCAGGGAACCCTGATCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2689.4) IGHD3-22*00(116) IGHJ4*00(341) nan 57 350 373 0 293 SG148TST152CSA159TSG160CSC214GST224ASA231GSG245CSG253ASA264CSA276GSA288TSC292TSC293ASG314CSG335C 2466.0 33 59 93 298 324 ST49C 116.0 31 68 68 327 364 SG52A 341.0 nan CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCT 40 GGTTACACCTTTACCATCTACGGT 40
42 160 0.00269066 CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTATGCAGAAAACCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATCACCGTGGTGGGACTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(3096.4) IGHD2-1500(35),IGHD2-2100(35),IGHD1-26*00(30) IGHJ3*00(500) nan 57 355 373 0 298 SA151TSC240GSG242ASG245C 2864.0 42 49 93 301 308 35.0;36 43 84 301 308 35.0;26 32 60 304 310 30.0
43 160 0.00269066 CAGGTGCAGGTGGTGCAGTCTGGGGCTGAGGTGAAGAGGCCTGGGTCCTCGGTGAACGTCTCTTGCAAGGCTTCTGGGGGTTACTTCAACAATCGTCAAACCCTCAACAGTTATCCTATCAGTTGGGTTCGACAGGCCCCCGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTCTCTTTGGTACAACAAACTACGCACAGAGGTTTCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACGACCTATCTGGAGTTGAACAATGTGACATCTGACGACACGGCCGTGTATTACTGTGCGAAGTCATGGGGGGGAGAGATCTACTACTACTACTACGCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2115.5) IGHD3-1600(35),IGHD4-1100(35),IGHD4-23*00(35) IGHJ6*00(550) nan 57 349 373 0 310 SC66GSA94GSG113CSC119TSA134GSC137TI138TI138AI138CI138TI138TI138CI138AI138AI138CI138AI138AI138TI138CI138GI138TI138CI138AI138AST141CSG145ASC149TSG153CSC161TSG167TST179CSA216CSG228ASA244GSC248TSG276ASA290GSG291ASC296TSA297CSC303TSG307ASG310ASC311TSC312GSG316CSG323C 1830.0 54 61 111 318 325 35.0;11 18 48 310 317 35.0;14 21 57 310 317 35.0
44 159 0.00267384 CAGGTGCAGCTGGTGCAGTCTGGGACAGAGGTGAAGAAGCCTGGGTCCTCGGCGAAGGTCTCCTGCAAGGCTTCTGGAGGCACATTCAGCAACTATGTGATAAGTTGGGTGCGACAGGCCCCTGGACAAGGCCTCGAGTGGATGGGGGGGATCATCCCTCTCTTTGGGACGACTGACTATGCCAAGAAGTTCCAGGGCAGAATCGCGATTACCGCGGACGAATCCACGACCACAGTCTACATGGATTTGAGCAGCCTGAGATTTGAGGACACGGCCGTCTATTTCTGTGAAATAGATGTGGGCTCCGGGGAGTTGTCTGTCGTCTGGGGCCAAGGGACCACGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2304.8) IGHD3-1600(41),IGHD3-1000(35) IGHJ6*00(351) nan 57 346 373 0 289 SG81AST83AST109CSC140ASG148ASC154TST155GSC158ASC161TSG188CST191CSA203GSA216CST224GSA227GSG228ASA230TSA231GSC236TSA239CSC240ASG258ASA261GSG286CSC292TSG302TSC303TSC319TSG335CSA340T 2020.0 55 66 111 306 317 SA63G 41.0;47 54 93 307 314 35.0 45 83 83 320 358 SC71T
45 158 0.00265703 CAGGTGCAGTTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAGGGTCTCCTGCAAGACTTCTGGTTACACCTTCATCAACTATGGTATCACCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGGTGGCTCAGCGCCTACAATGGTGACACAAGCTCTTCAGAGAAGCTCCAGGACAGGTTCACCATGACCACAGACACATCCACGAACACAGTGTATATGGACCTGAGGAGCCTGACATCTGACGACACGGCCGTATATTACTGTGCGAGATGGAGCGCCATAGTGGGAGGTGCTGAAGCTCTTGATGTCTGGGGCCAAGGGACAATGGTCATCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2422.8) IGHD1-26*00(50) IGHJ3*00(384) nan 57 351 373 0 294 ST62GSC66TSA112GSG126AST143CSC145TSG148ASG160CSA203GSA207CST215CSA225GSA232GSA235CSG237TSC240GSG253ASA257GSG258TSG286ASC292TSC293GSC296TSG302CSG316CSG335A 2186.0 23 33 60 303 313 50.0 20 70 70 317 367 ST23AST27CSA33GSC58T 384.0 nan CAGGTGCAGTTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAGGGTCTCCTGCAAGACTTCT 40 GGTTACACCTTCATCAACTATGGT 40
46 158 0.00265703 CAGGTGCAGCTGGTGCAGTCTGGGACTGAGGTGAAGAAGCCTGGGGCCTCGGTGAAAGTCTCCTGCAAGGCCTCTGGAGGCACCTTCAGTAGGTCTGGTTTCCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATGATCGTCCCCAGTGTTGACACAACAAACTACGCACAGAAGTTCCAGGCCAGAGTCACGATTAGCGCGGACCAGTTCACGAGCACAGTCTACATGGAGTTGAGAAGCCTGAGATCTGAGGACACGGCCGTATATTATTGTGCGAGATGTCCACAGCCTCCAGATACTGCTGACCCTTACGCTGTGGACGTCTGGGGCCAAGGGACCAGGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2339.7) IGHD6-1300(32),IGHD6-1900(32),IGHD5-5*00(31) IGHJ6*00(374) nan 57 351 373 0 294 SG81AST102GSG113AST128CSC146TSC149GSA151CSC154GSA156TSA159CSG160ASG204ASG205TSA210GST215CST217GSC218TST219GSG223AST224CSG228ASG253CSC268GSG276CSA278GSC280TSC292TSC303TSC308ASG335ASC341T 2041.0 3 15 63 306 318 SC7ASG9A 32.0;3 15 63 306 318 SC7ASC8T 32.0;23 32 60 309 318 SA28T 31.0
47 152 0.00255613 CAGGTGAGGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCGAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTGTCACCTGGGTGCGGCAGGCCCCGGGACAAGGGCTTGAGTGGATGGGCGGGATCATCCCCATCGTTACTACACCAAACTACGCACAGAAGTTCCAGGGCAGACTCACGATCTCCGCGGACAAATCCACGAGCACATCTTACATGGAGTTGAGCAGCCTGAGATCGGAAGACACGGGCGTCTATTACTGTGCGAGAGTTGGTTACAACTTTTGGAGTCGTTATCACTACTACGGAATGGACGTCTGGGGCCAAGGGACCACGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2535.4) IGHD3-3*00(68) IGHJ6*00(482) nan 57 352 373 0 295 SC63ASA64GSA123GSA156GSG160CSA170GST179GSA203CST215CST219GSG222ASG223CSG228CSG258CST266CSA267TSG276ASG291TSC293TSC303TST320GSG323ASC331GSG335C 2254.0 34 56 93 299 321 SG38AST40CSG50C 68.0 29 83 83 322 376 ST39ASC71T 482.0 nan CAGGTGAGGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCGAGGCTTCT 40 GGAGGCACCTTCAGCAGCTATGCT 40
48 152 0.00255613 CAAGTTCAGCTGGTGCAGTCTGGAGCTGACGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACAATTTTACCAGCTATGGAATCAGTTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCCCTCATAATGATAGAACAAAGTATGCACGGAGATTCCAGGACAGAGTCACCATGACCACAGAGACACCCACGAGCACAGTCTACATGGAGCTGGGGAGCCTGAGATCTGACGACACGGCCGTTTATTACTGTGCGAGAGACCTCTATTATAGCAGTGGCCGGTACTTTGATCATGATGCTTTTGATATCTGGGGCCAGGGGACAGTGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2533.6) IGHD6-19*00(76) IGHJ3*00(482) nan 57 358 373 0 301 SG59ASG86CSC139ASC140TST155ASC161TSG213CST216CSC218TSG223ASA226GSC227ASC233GSA241GSA244GSG245ASC246TSG253ASC275GST279CSC292TSA306GSG335TST353C 2314.0 24 42 63 303 321 ST36C 76.0 16 70 70 325 379 SA44GSA51G 482.0 nan CAAGTTCAGCTGGTGCAGTCTGGAGCTGACGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCT 40 GGTTACAATTTTACCAGCTATGGA 40
49 146 0.00245523 CAGGTGCAGCTGGTGCAGTCTGGGACTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCCTCAGCAACAATGCTATCAGCTGGGTGCGCCAGGCCCCTGGACAAGGGCTTGAGTGGATGGGCGGGATCATCCCTCTCTCTGCTACAACAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAGATCCACGAGCACAGCCTACATGGAGCTGACCAGCCTGACATCTGAGGACACGGCCGTCTATTACTGTGCGCGAGGATTTGATGATAGGGGGATTGTAGTAGTACCAGCTGCTAACCCTTGGTATTATGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2788.3) IGHD2-2*00(110) IGHJ6*00(462) nan 57 352 373 0 295 SG81AST141CSG148AST150ASA170CSA203CSA216CST220CSG223CSG228ASG276ASA277GSG307CSG316CSG335CSA348C 2486.0 36 58 93 312 334 110.0 31 83 83 342 394 SC33TSC36T 462.0 nan CAGGTGCAGCTGGTGCAGTCTGGGACTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCCTCAGCAACAATGCT 40
50 145 0.00243841 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCGTGCACGGCTTCTGGGGGCCCCTTCAGTAGCTATGCCATCAACTGGGTGCGACAGGCCCCTGGACAGGGGCTTGAGTGGATGGGCGTGATCACCCCCATGTTTGGAGCACCACACTACGCACAGAACTTCAAGGGCAGAATCACCATTACCGCGGACAAGTCGACGAACACGGCCTACATGGAACTGAGCAGCCTGACGTCTGGGGACACGGCCGTTTATTTCTGTGCGAGAGTGTTCACCGGTCGTTGGTTCGACCCCTGGGGCCAGGGGACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2354.6) IGHD1-2600(30),IGHD1-700(30),IGHD3-3*00(30) IGHJ5*00(431) nan 57 352 373 0 295 SC119GSA124CSA134GSA138CSC146TST155CSG160ASA185GSA203CSG205TST211CST215CSC218GST224ASA225GSG228CSA231CSG245CSC249ASG258ASG263CSG276ASA278GSC281GSG286ASA290GSG302ASG316CSA317GSA322GSG335TSA340T 2022.0 17 23 60 300 306 30.0;14 20 51 300 306 30.0;59 65 93 300 306 30.0
51 142 0.00238796 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCACCTATTCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGAGCCCCCCTATCTTTGGTACATCAAAGTACGCACAGAATTTTCAGGGCAGAGTCACGATCACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGATGACACGGCCGTGTATTACTGTGCGAGAGGGGGCCGGTATCCCAAATCTTCCTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2915.4) IGHD1-2600(35),IGHD1-700(35),IGHD3-3*00(35) IGHJ6*00(560) nan 57 352 373 0 295 SG148CSG153TST208GSA210CST211CSG228TSC233GSG245TSC248TST266CSG323T 2631.0 18 25 60 299 306 35.0;15 22 51 299 306 35.0;60 67 93 299 306 35.0
52 141 0.00237114 CAGGTGCAGTTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGTCGTCAGTGAAGGTCTCCTGCAAGGCTTCTGGAGACACAGACACAAATTATGTTATCAGTTGGGTGCGACAGGCCCCTGGACAGGGGCTTGAATGGATGGGAGGAATCTTCCCTAAATTTGGAACAACATACTCTGCCCAGAAGTTGCAGGACAGACTCACGATTACCGCGGACGAAAGTACGTCCACAGTCTACATGCAACTGAGCAGCCTGAGACTTGACGACACGGCCGTCTATTACTGTGAGGCGGAAATGACTTTTGGGAAGTTATCAGTCGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2039.2) IGHD3-16*00(47) IGHJ6*00(380) nan 57 346 373 0 289 SC66TSG86ASC104GSG107ASG136ASC140AST141GST142ASG145CSC146ASG148ASC149TSC154TSC161TSA185GSG194ASG206ASA210TST217ASC218AST224ASG228ASA231TSA235CSC236TSA239CSC248GSG253ASG258CST279ASC280GSC281TSA285TSG286CSC292TSG300CSG302AST318CSC319TSG323CSG335C 1701.0 51 66 111 302 317 SG54TSG58A 47.0 45 83 83 320 358 380.0 nan CAGGTGCAGTTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGTCGTCAGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGACACAGACACAAATTATGTT 40
53 140 0.00235433 CTGGTGCAGCTGGAGCAGTCTGAAACTGAGGTGAGGAAGCCTGGGTCCTCGGTGAAACTCTCCTGCAAGACTTCTGGAGACTCCTTCAACGATTATGCCATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGAATCATCCCTATCTTGAATTTAGTGAGATACGCAGAGAAGTTCCAGGGCAGAGTCACCATTAGCGCGACCGACTCCACGGGCACAGCCTACTTGGAGGTGACCAGGTTGAGATCTGAGGACACGGCCACATATTATTGTGCGACTGCGACCGAGAGCACCCCCGGGGGACGTTTGGACGTGTGGGGCCTAGGGACCACGGTCTCCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(1949) IGHD6-1300(30),IGHD6-1900(30),IGHD6-25*00(30) IGHJ6*00(334) nan 57 349 373 0 292 SA58TST70ASG79ASG80ASG81ASA91GSG113ASG114CSG126ASG136ASA138TSG145ASA147GSG148ASC149TST155CSG206AST221GSG222ASG223ASA225TSC226TSC229TSA230GSA232GSC233ASC240GSG263CSC268GSG273ASA274CSA278CSA285GSA297TSC303GSG307CSC311GSC312TSG333AST334CSG335ASC341T 1702.0 18 24 63 309 315 30.0;18 24 63 309 315 30.0;15 21 54 309 315 30.0
54 139 0.00233751 CAGGTGCAACTGGTGCAGTCTGGGGCTGAGGTGAAGCAGCCTGGGTCCTCGGTGAAGGTCTCCTGCCAGGCCTCTGGAGTCACCTTCAGCAGCTTTGCAATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTCGTACACCAAACTACGCACAGAACTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGTTCAGTCTACATGGAGCTGAGCAGACTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAAGTACGGGAAGTGGCTTCCGACCTGGGACGCATAGATTCAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2824) IGHD5-1200(35),IGHD5-1800(35),IGHD6-19*00(35) IGHJ5*00(500) nan 57 351 373 0 294 SG65ASA93CSA123CST128CSG136TSA151TST155ASG222CSG228CSG245CSC287TSA288TSC292TSC311A 2534.0 31 38 69 303 310 35.0;31 38 69 303 310 35.0;30 37 63 303 310 35.0
55 138 0.00232069 CAGGTGCAGCTGGTGCAGTCTGTGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTTAAGGTCTCCTGCAAGGCTTCTGGAGACTCCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACACGGGCTTGAGTGGATGGGACGGATCATCCCTATCTTTGGCACACCAAACTACGCACAGAGGGTCGAGGGCAGAGTCACGATAACCGCGGACGAATCCACGAGCACAGCCAACATGGAACTGAGCAGCCTGAGATCTGACGACACGGCCGTCTATTATTGTGCGACTGGGGGCAATTACTATGAAACTAGTGCTTTGGCCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2685.3) IGHD3-22*00(63) IGHJ4*00(380) nan 57 349 373 0 292 SG79TSG110TSG136ASA138TSA185CSG204CST224CSG228CSA244GST246GSC249GST266AST294ASG302ASG323CSG335CSC341T 2427.0 33 54 93 301 322 ST43ASG45CSG51C 63.0 30 68 68 326 364 380.0 nan CAGGTGCAGCTGGTGCAGTCTGTGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTTAAGGTCTCCTGCAAGGCTTCT 40 GGAGACTCCTTCAGCAGCTATGCT 40
56 138 0.00232069 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCCCCTTCAGCAACTATGCTATCAACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTACCTTTACTACAGGGATCATCCCTATCTTTGGTACACCAACCTACGCACAGAACTTCCAGGGCAGAGTCACCATTACCGCGGACGAATCCACGAGTACAGCCTACATGGAGCTGAGTAGCCTGAGATCTGACGACACGGCCGTCTATTACTGTGCGAGAGATGTTTTGGTCGGATACAGCAGTGGCTGGCATTCCTATCGTAATTCTGTAGGTGGAATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2604.3) IGHD6-19*00(67) IGHJ6*00(431) nan 57 354 373 0 321 SA138CSG148ASG160AI217CI217CI217TI217TI217TI217AI217CI217TI217AI217CI217AI217GI217GI217GI217AI217TI217CI217AI217TI217CI217CI217CI217TI217ASG228CSA232CSG245CSG263CSC287TSC308TSG323CSG335C 2336.0 20 39 63 329 348 SG23AST26C 67.0 37 83 83 372 418 ST39A 431.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCCCCTTCAGCAACTATGCT 40
57 138 0.00232069 CAGGTGCAGCTGGTGCAGTCTGGGGCCGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCATCCGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACTGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTGATGGTGGTGGCACTAGCTACGCACAGCAATTCCAGGGCAGAGTCATCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGATGAGCAGCCTGAGATCTGAAGACACGGCCGTGTATTACTGCGCCGTCGGCGGTAACTACTTAAGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-46*00(3060.6) IGHD4-2300(26),IGHD1-700(25),IGHD3-3*00(25) IGHJ6*00(453) nan 57 347 373 0 290 ST83CST116CST131CSA172TSA216GSG217ASA225GSA230TSA243CSG245ASC262TSC303ASG323AST344C 2494.0 25 33 57 293 301 ST28C 26.0;16 21 51 296 301 25.0;61 66 93 296 301 25.0
58 136 0.00228706 CAGCTGCAGCTGGTGCAGTCTGGGACTGAGGTGAAGGAACCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCACCTCTTCTTTCGTCTGGGTGCGACAGGGCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTCACTAGGACAAATTTCGCACAGAAGTTCCAGGGCAGAGTCACCTTTAGCGCGGACGAATCCACGCGAACAACCTACATGGAACTGCGCAGCCTGACATCTGAGGACACGGCCATATATTACTGTGCGAGAGACGTGGTGCGGTCTACTGCGGGGGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2341.2) IGHD2-15*00(38) IGHJ400(342),IGHJ500(342) nan 57 353 373 0 296 SG60CSG81ASA93GSG95ASG148CSA151CSG153TSA156TSA159GSG160TSC175GST221CSG222ASG223CSC226GSA227GSG228ASC233TSA235TSG263CSA264TSC268GSA285CSC287ASG291ASG302ASA306CSG316CSG333ASG335A 2090.0 45 64 93 297 316 DA50ST53GI55TSC60G 38.0 28 68 68 318 358 SA32CSC63T 342.0;31 71 71 318 358 SC34TSC66T
59 135 0.00227024 CAGGTACTATTGGTACAGTCTGGGGCTGACGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGACTTCTGGATACACATTCACCGAATTCGATATCAACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAATGGATGGGATGGATGAACACTAATACTGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTTACCATGACCAGGGACACCTCCATCAGCACAGCCTACATGGAGCTGAGAAGACTGAGATCTGAGGACACGGCCGTCTATTATTGTGCGAGAGTGGTCCGCTTTTTTGGCGGGCACGCCGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-8*00(2478.3) IGHD3-3*00(35) IGHJ4*00(380) nan 57 352 373 0 295 SG62ASA64TSG65ASC66TSG71ASG86CSG126ASC140ASA147GSG148AST149ASA151TST152CSA177CSG194ASC213ASC218TSG220CSC260TSA273GSA284CSC308ASC311ASG335CSC341T 2225.0 40 47 93 304 311 35.0 30 68 68 323 361 380.0 nan CAGGTACTATTGGTACAGTCTGGGGCTGACGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGACTTCT 40 GGATACACATTCACCGAATTCGAT 40
60 134 0.00225343 CAGGTGCACCTGGTGGAATCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAACGTCTGGATTCACATTCACCAATTATGTCATGCACTGGGTCCGCCAGACTCCAGGCAAGGGGCTGGAGTGGGTGGCAAATGTTTGGTATGATGGAAGACAAAAATGGTATGCAGACTTAGCGAAGGGCCGATTCACCATCTCCAGGGACAACTCCGAGAACACGGTGTCTCTACAAATGAACAGCCTGAGAGTCGAGGACACGGCTGTATATTATTGTGCGACAGAGCCCGTTGAGTCAATCTGGAGGATTGGCAGCTGGGGGATTGACAACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-33*00(2118.8) IGHD2-200(40),IGHD6-1300(40),IGHD3-16*00(35) IGHJ4*00(391) nan 57 353 373 0 296 SG65CSG74ASG126ASC140ASG145CST146CSG148ASC149TSG154TSG174ASG204AST205ASA207GSA209TST224ASA225CST227ASA232GSC233GSC244TSC245AST247CSA272GST278CSA282GSC291GSA295CSG299ASC319TSG335ASC341TSG349C 2032.0 6 14 93 322 330 40.0;31 39 63 322 330 40.0;53 60 111 327 334 35.0
61 133 0.00223661 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGTAGCTATACTTTCAGCTGGGTGCGACAGGCCCCTGGACAAGGACTTGAGTGGATGGGAGGGATCGTCCCTCTCTTTGGTACAACAAACGACGCAAAGATTTTTCAGGGCAGAGTCACGATTTCCGCGGACGAATCCACGAGCACAGTGTACATGGAGCTGAGCAGCCTCAGATCTGAAGACTCGGCCATGTATTATTGTGCGAGAGATGGCGATGTTACGTCAACTCGTCCCAGAGGTGCTTTTGATATCTGGGGCCAAGGGACAGTGATCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2625.9) IGHD5-500(38),IGHD5-1200(36),IGHD6-6*00(36) IGHJ3*00(412) nan 57 354 373 0 297 SG107ASC146TSG153ASA156TSG188ASA210GSA216CSG228AST234GSC240ASA244TSG245TSC248TSA267TSC292TSC293GSG314CSG323ASA327TSG333ASC341T 2361.0 35 45 60 303 314 I42C 38.0;42 54 69 304 318 I48CI50C 36.0;26 36 54 310 320 SG28A 36.0
62 132 0.00221979 CAGGTTCAACTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAAACTTCTGGTTACACCTTTACCAACCACGGAATCAACTGGGTGCGACAGGCCCCAGGACAAGGGCTTGAGTGGATGGGATGGATCAATCCTTACAATGCTAATGTGAACTATGCACAGAAACTCCAGGGCCGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGACCTGAGGAGCCTGACATCTGACGACACGGCCGTCTATTACTGTGCGAGAGATCGAGTCGCGGGAATTTGGGGGGATGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2598.3) IGHD3-16*00(45) IGHJ3*00(461) nan 57 355 373 0 298 SG65ASG125ASG126ASG148AST150CST152CST155ASG160AST179ASG211ASC212TSG213CSG223CSC227TSA228GSC229TSA230GSG245ASA255CSG302CSG316CSG335C 2342.0 50 59 111 309 318 45.0 21 70 70 318 367 SA44G 461.0 nan CAGGTTCAACTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAAACTTCT 40 GGTTACACCTTTACCAACCACGGA 40
63 132 0.00221979 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAGGGTCTCCTGCAAGGCTTCTGGAGGCACCCTCAATAGCTACACTATCAGTTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGAGGGATCATCCCTGTCTTCGGGACAACAGACTACGCACAGAAGTTCCAGGGCAGAGTCACAATTACCGCGGACCAGTCCACGGGCACAGCCTACCTGGATCTCTTCAGCCTGAGATCTGAGGACACGGCCATATATTACTGCTCGATCAGCAACTCATACGGTCGTGGGGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2450.4) IGHD4-2300(31),IGHD4-1700(30),IGHD6-6*00(29) IGHJ4*00(371) nan 57 344 373 0 287 SA112GST141CSG145ASC146TST152CSG153ASC161TSG188CSA216GST221CST224GSG228ASA231GSG263ASG276CSA278GSA285GSA297CSG302TSG305CSA306TSG307TSG333ASG335A 2174.0 23 32 57 303 312 SG29C 31.0;20 26 48 303 309 30.0;24 41 54 294 311 SG28ASG32ASC34ASA38T 29.0
64 132 0.00221979 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTCACCAGTTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGAACTACCACAGACTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACATACTACATGGAACTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGACCCCAGATCGCCAGCCACTACTATTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-46*00(3214.7) IGHD7-2700(31),IGHD6-1900(30) IGHJ6*00(541) nan 57 351 373 0 294 SC149TST221ASG222ASG223CSG226CSA231GSG232ASG291TST292ASG302A 2650.0 20 29 33 299 308 SC24G 31.0;3 9 63 304 310 30.0 26 83 83 310 367 SC33T
65 132 0.00221979 GAGGTGCAGCTGTTGGAATCTGGGGGAGGCTTGGTACAGCCGGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGGCATGACCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATTTAGTAGTGCTACTGGTGCTGGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATTTCCAGAGACAATTCCAAAAACACGCTGTATCTGCAAATGACCAGCCTGAGAGCCGACGACACGGCCGTCTATTATTGTGCGAAGGATCGCCGGGCAGGGGGGAACTATGGCTTTTATTCCGACTTCTGGGGCCAGGGAGCCCTGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-23*00(2553.5) IGHD1-700(35),IGHD3-1000(35),IGHD3-22*00(30) IGHJ4*00(313) nan 57 355 373 0 298 SG74AST98GSC154GSG160CSG204TSC205TST208GSG214CSG217CSG223CSA225GSC266TSG284ASA307CSG323CSA335CSC341TSA350G 2458.0 26 33 51 310 317 35.0;36 43 93 313 320 35.0;36 42 93 313 319 30.0
66 130 0.00218616 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTTAAGGTCTCCTGCAAGATTTCTGGAGGCACCTTCACCAACTATGTTATCAGTTGGCTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGCTCATCCCTATCTTTGGGGCAGCAAATCTCGCACAGAAGTTCCAGGGCAGAGTCACGATAACCGCGGACGAATCCACGAGCACAGTCAACATGGAGTTGAGCAGCCTCACATCTGAGGACACGGCCGTCTACTACTGTGCGAGAGGCAGATCGTCTCCCAACTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2547.6) IGHD6-6*00(36) IGHJ5*00(430) nan 57 352 373 0 295 SA91GSG110TSG126ASC127TSG145CSG148ASC154TSC161TSG165CSA207CST224GSA225GSC233TST234CSA235TST266ASC292TST294ASC303TSG314CSG316CSG335CST338C 2283.0 25 35 54 295 305 SC29A 36.0 28 71 71 312 355 430.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTTAAGGTCTCCTGCAAGATTTCT 40 GGAGGCACCTTCACCAACTATGTT 40
67 127 0.00213571 CAGGTCCAACTTGTCCAGTCTGGGGCTGAGCTGAAGAAGCCTGGGGCCTCAGTGAACATTTCCTGCACGGCTTCTGGATTCACCTTCAGTGACAATCTTATAAATTGGGTGCGCCAAGTCCCCGGACAAGGCCTTGAGTGGATGGGATGGCTCAACCCTGACACTGGAAACACAAGATATTCAGAGACGTTCCAGGGCAGAGTCACCATTTCCAGGCACCCATCCGCGAGCATAGCCTACTTGGAACTGAGCGGCCTGGAAAATGAAGACACGGCTCTCTATTTCTGTGCGAGAGACATACAGAGCGTCGGCCCGCGGGCGAATGATGCTTTTGATGTCTGGGGCCAAGGGACCATGATCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(1985.8) IGHD2-800(30),IGHD5-500(30) IGHJ3*00(423) nan 57 353 373 0 296 SG65ASG71CSG87CSG113CSG114ASA124CSA136TSC145GSA147GSG148AST150ASG153CSC154TSG158ASC159ASG173ASC175TSA186GSG188CSA207CSG213CSG217ASA220CST224ASA232GSC240GSA244CSA267TSG273CSA276CSC289TSA297TSG302ASA309GSA315GSG316AST318ASC319ASG333CSG335CSA340T 1771.0 7 13 93 296 302 30.0;24 30 60 297 303 30.0 19 70 70 322 373 SA33GSA50CSG54A
68 127 0.00213571 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCGCCTTCAGCAGCTTTGATATCAGCTGGGTGCGACAGGCCCCTGGACTAGGGCTTGAGTGGATGGGAGGGTCCATCCCTGTACTTGGAACAACAAGCTATGCACAGAAGTTCCAGGGCAGAATCACGATTACCGCGGACGCATCCACGAGGACAGCCCACATGGAGCTGTACAGTCTGAGACCTGACGACACGGCCATTTATTACTGTGCGAGAGCGAGGGCCGAGCGCGAACGTTCTTACGACTTTTGGGGTGGCTCATTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2519.8) IGHD3-3*00(62) IGHJ4*00(401) nan 57 352 373 0 295 SA138GSA151TSC154ASA184TSA207TST208CSA216GSC218AST219CST224ASG228ASA232GSC236TSG258ASA277CSC287GST294CSA306TSG307ASC311TST318CSG323CSG333ASG335T 2254.0 34 52 93 317 335 ST40CSA47G 62.0 25 68 68 339 382 SA32C 401.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCGCCTTCAGCAGCTTTGAT 40
69 126 0.00211889 CAGGTGCGATTGGTGCAGTCTGGGGCTGAGGTGAAGGAGCCTGGAGACTCAGTGAGGGTCTCCTGCGAGGCTTCTGGATACACTTTCACCGCCTACCATATACACTGGGTGCGGCAGGCCCCTGGACAAGGACTTGAGTGGATGGGATGGATCAACCCTAAGTTTGGTGACACAGGCTATGCACAAGACTTTCAGGGCAGGGTCTCCATGACCAGCGACATGTCCATCAGCACAGTCTACATGGAGTTGAGCAGGCTGACCTCTGACGACACGGCCATATATTACTGTGCGAGAAATATGGACTATTATTATGGTCGGGGCAGCGGCAACGGACATGGTGTCTGGGGCCAAGGGACCACGGTCACCGTCTTCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-2*00(2338.9) IGHD3-1000(46),IGHD6-2500(46) IGHJ6*00(341) nan 57 354 373 0 297 SA64GSG65ASC66TSA93GSG101ASC103ASA112GSA123GSC140TSG148CST153CSG158ASA170GSG188ASC218GSA219TSG220TSG226ASA231GSA232GSG242ASA243GSG245CST255ASA261TSG272CSC277TSC292TSC303TSG316CSA317CSG333ASG335ASG351A 1984.0 32 44 93 303 315 SC37T 46.0;25 37 54 319 331 ST33A 46.0 46 83 83 339 376 SC77T
70 126 0.00211889 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAGGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCCTCTGGATACAGCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCGGGACAAGGGCTTGAGTGGATGGGATGGATCATCCCTCATAGTGGTGAGACAAACTATGCACAGAAGTTTCAGGCCAGGGTCACCCTGACCAGGGACACGTCCATCAGCACAGCCTACATGCAGCTGAGCGGACTGACATCTGACGACACGGCCGTGTATTACTGTGCGAGAGAGACCGATGACTTCACTAACGGGGCCCATGACCTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-2*00(2828.6) IGHD4-1100(42),IGHD4-400(42) IGHJ5*00(371) nan 57 353 373 0 296 SA94GST128CSC139GST179GSA211TSA216CSC218TSG226ASC227GSG253CST255ASA264CSG300CSA309GSG311ASG316C 2496.0 15 29 48 301 315 SA21TSG24C 42.0;15 29 48 301 315 SA21TSG24C 42.0 31 71 71 324 364 SC35T
71 126 0.00211889 CAGGCTCAGTTGGTCCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAACGTCTCCTGCAAGGCTTCTGGTTACGACTATGTGACCTATGCTATCACGTGGGTGCGACAAAGGCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCACTCTCAATGGGAACACAAACTACGCACAGAATTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGAATAGTCCACTTGGAGCTGAGGAGTCTGAGATCTGACGACACGGCCGTTTACTACTGTGCGAGAAGGGTACAGGTGTGGTTGCCAGATTATTACGGCATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2201.3) IGHD5-5*00(38) IGHJ6*00(462) nan 57 351 373 0 294 ST61CSC66TSG71CSG113CSA138GSC139AST142ASA144GSC145TSC146GSG148CSG154CSG160CSC161GSG173ASG174ASC175GSC176GSG213AST216CSA217TST224GST236CSG245TSC246TSC287ASC289TSC292TST294CSA297TSC311TSG335TST338C 1983.0 22 38 60 295 311 SA24GSC30GSA32G 38.0 31 83 83 318 370 SC33TST39C 462.0 nan CAGGCTCAGTTGGTCCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAACGTCTCCTGCAAGGCTTCT 40 GGTTACGACTATGTGACCTATGCT 40
72 125 0.00210208 CAGGTCCACCTGGTGCAATCTGGGGCTGAGCTGAAGAGGCCTGGGTCCTCGGTGAGGCTCTCCTGCAAGGCCTCTGGAGGCACCTTCAGCATCTTTGCTATCAATTGGGTGCGCCAGGCCCCTGGACAAGGGTTTGAGTGGATGGGAGGGATCATCCCTCGGTTTAATAAAGTTAGCTTTCCAGAGAAGTTCCAGGGAAGAGTCACCTTTACCGCCGACGAATCCACCACTACAGCTTATATGGACTTGACCCGCCTGGGCTTTGAAGACACGGCCACATACTTTTGTGCGAGAGATAAAGGAGGCACACGGGGATACAGTGGCTACGACGCCTTTGACTCTTGGGGCCAGGGGACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(1816) IGHD5-12*00(82) IGHJ4*00(353) nan 57 354 373 0 297 SG62CSG65CSG74ASG87CSA94GSA112GSG114CST128CSG148TSA151TSG160ASC161TSA170CSC189TSA216CST217GSC218GSG222ASG223ASC226ASC229TSA230TSA232GSA235TSC236TSG237CSC240GSC254ASG263CSA264TSG272CSG284CSG286CSC287TSC293TSC296TSG302CSC303TSG307CSA309CSA315GSA317CSC319TSG323ASG333AST334CSG335AST338CSA340TSC341T 1520.0 20 42 69 307 329 ST24GST30C 82.0 24 68 68 332 376 SA32CSC33TSA45G 353.0 nan CAGGTCCACCTGGTGCAATCTGGGGCTGAGCTGAAGAGGCCTGGGTCCTCGGTGAGGCTCTCCTGCAAGGCCTCT 40 GGAGGCACCTTCAGCATCTTTGCT 40
73 123 0.00206844 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTTCTGCAAGGCCTCTGGAGGCACCTTCAGCAACTATACTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTGTCTTTGGAACAACAGACTACGAACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGGATCCACGAGCACAGCCTACATGAAGCTGAGCAGCCTGAGATCTGCGGACACGGCCGTGTATTATTGTGCGAGATCCTCCCCCTATATAGTAGTACGAAAACCTACTGGGAACCAGGACTATTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2843.7) IGHD3-2200(49),IGHD2-200(45),IGHD5-12*00(44) IGHJ6*00(511) nan 57 351 373 0 294 SC118TST128CSG148ASG153ASA216GST224ASG228ASA231GSC238ASA277GSG300ASA322CSC341T 2563.0 16 32 93 302 317 DC20SA27G 49.0;40 49 93 307 316 45.0;27 42 69 304 318 SG34ADC36 44.0
74 122 0.00205163 CAGGTGCACCTGGTGCAGTCAGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCACGGCTTCTGGATATGACTTCAACATTTATGATATCCACTGGGTGCGACAGTCCACTGGACAGGGGCTTGAGTGGATGGGATGGATGACCCCTAAGCGTGAAACCCCAGGCTATGCACCGAAGTTCCAGGGCAGATTCACCATGACCAGGGACACCTCCAGAAGTGCAGTTTACATGGAGCTGAGCAGCCTGGGATCTGAGGACACGGCCGTGTATTTCTGTGCGCGGGGCGGCCACGGTTTCTGGAGTGGTGAAACGTACTACTACGCCATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-8*00(2540.9) IGHD3-3*00(57) IGHJ6*00(492) nan 57 354 373 0 297 SG65CST77ASA124CSC137TSA138GSC139ASC145ASG148TSA159CSG174TSA185GSA211CSC218GSA219CSG223AST224ASA226CSA228CSA241CSG258TSA273GST283GSC287TSA288GSC292TSC293TSA315GSA340TSA348CSA350G 2100.0 36 53 93 301 318 SA39GST43C 57.0 28 83 83 324 379 SG38CST39C 492.0 nan CAGGTGCACCTGGTGCAGTCAGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCACGGCTTCT 40 GGATATGACTTCAACATTTATGAT 40
75 122 0.00205163 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCACCACCTATGATATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGGGGGATCATCCCTTTGTTTGATGCAACAAAGTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAGTCCACGGGCACAGCCTACATGGAATTGAGCAGCCTGAGATCTGAGGACACGGCCATGTATTACTGTGCGAGAGATCGAAGTAGTAGCTGGTACAATGGGACATTCTACTTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2783.2) IGHD2-200(51),IGHD6-1300(47),IGHD6-19*00(47) IGHJ4*00(441) nan 57 355 373 0 298 SA91GSG145CSG148CSC154ASA203GSA216TSC218GSG223ASA225GSG228ASC233GSG276ASA278GSA285GSG302ASC303TSG333A 2487.0 4 17 93 302 315 SC7T 51.0;27 42 63 300 315 SC29TSC32T 47.0;27 42 63 300 315 SC29TSG33A 47.0
76 115 0.00193391 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGACACCTTCACGACTAATAGTCTCAACTGGGTGCGACAGGCCCCTGGACAAGGACTTGAGTGGATGGGAGGGATCATCCCTGTGGTTGGTACAACAAAATACGCACAGAAATACCAGGACAGAGTCACCATCACCGGGGACAAATCCACGAACACAGCCTACATGGAACTGAGCAGCCTGAGATCTGACGACACGGCCGTCTATTACTGTGCGAGAGGTCTCTTGTACGCTACCACTTACTTTGATTACTGGGGCCAGGGAACCCCGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2478.8) IGHD2-1500(40),IGHD6-1300(38),IGHD6-19*00(38) IGHJ4*00(402) nan 57 358 373 0 301 SG136ASG145CSC146GSG148CSC149TST150ASG153ASC154GSA156CSG160ASG188ASA216GSC218GST219GSG228ASC233ASG245AST247ASG253ASG263CST266CSC271GSG276ASG286ASG302ASG323CSG335CSA352G 2198.0 9 17 93 306 314 40.0;38 48 63 302 313 I43C 38.0;38 48 63 302 313 I43C 38.0
77 115 0.00193391 CAAGTTCACTTGGTGCAGTCTGGAGGTGAACTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACAGCTTTAGTGACTTCGGTATAACGTGGGTGCGACAGGCCCCTGGACAAGGACTTGAATGGATGGGATGGATCAGCGGTAAAAATGGGAACACAAATTATGCACAGAAGGTCCAGGGCAGAGTCACCTTGACCGCGGACACATCGACGAGCACAGCCTACATGGAGATGAGGGCCCTGACATCTGACGACACGGGCATATATTACTGTGCCCGCAGTGACTACTACGAAGACACTGGCACGTTTGAAAACTGGGGCCAGGGAACCCCGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2175.9) IGHD1-2600(41),IGHD2-200(40),IGHD4-17*00(40) IGHJ4*00(343) nan 57 347 373 0 290 SG59ASG65CSC66TSC82GSG86ASG87CSC139GSC145GSC146TSA147GSG148ASA151TST152CSC158ASG160CSC161GSG188ASG194ASC214GST216ASC218AST224GSC233TSC246GSA264TSA270GSA272GSC281GSC303ASA309GSG310CSG316CSC331GSG333ASG335A 1885.0 33 44 60 299 310 ST41A 41.0;15 23 93 298 306 40.0;24 32 48 295 303 40.0
78 114 0.00191709 CAGGTGCAGGTGGAGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGCTGAAAGTCTCCTGTAAGACCTCTGGAGGCCCCTTCAGCAGCCAAGCTTTCAACTGGGTGCGACAGGCCCGTGGACATGGGCTTGAGTGGATGGGAGGCATCATCCCTCTTCTTGGCTCAACAACCTACGCACAGAAGTTCCAGGACAGAGTCACGTTTACCGCGGACGAATCGACGAGCACAGTCTACATGGAGTTGAGAAGCCTGAGATCTGAGGACACGGCCACCTATTTTTGCGCGATGAGTGATGGTCCTTACTTTTATTACGTTATCGACGTCTGGGGCCGAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2231) IGHD1-700(40),IGHD3-1600(37),IGHD6-13*00(35) IGHJ6*00(406) nan 57 333 373 0 276 SC66GST70ASG108CSG113ASC122TSG126AST128CSA138CST150CST152ASA156TSG160ASC178GSA185TSG206CSA216CSC218TST219CST224CSA225TSG228ASA232CSG253ASA264TSC281GSC292TSC303TSC308A 1948.0 2 10 51 187 195 40.0;58 75 111 199 214 ST62CDT64DA69 37.0;29 36 63 86 93 35.0
79 112 0.00188346 CAGCTTCACTTGGTGCAATCTGGGGCTGTTGTGAAGAAGCCTGGGGCCTCAGTGACGGTTTCCTGCTCGGCATCTGGATACCCTGTCACTGCCTACTATATGCACTGGGTGCGACAGGCCCCTGGACGAGGGCTTGAGTGGATGGGAGGGATCAACCCTGCCACTGGCGCCGCAAAGTATACACAGACATTCCAGGGCAGGGTCACCATGACCAGGGACACGTCCACGAGTACAGTCTTCATGGAACTGAGCGGCCTGACATCTGAGGACACGGCCGTCTTTTACTGTGCGAGAGGGGGGGGGTTGGAGTGGCTGGATCTGCTGCTTTTGATATGTGGGGCCAAGGGACCTTGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-46*00(2266.3) IGHD3-300(45),IGHD6-1900(45) IGHJ3*00(384) nan 57 352 373 0 295 SG60CSG62TSG65CSC66TSG74ASA85TSG86TSA112CSA123TSA124CSA138CSC140TST141GSC146TSA147GSG148CSA184GSA204GST205GSA206GSA216GSG217CST218CSG219ASG220CST224CSA225GSG226CSA228GSG232ASC233GSC236TSG237ASA244CSG245ASA257GSC287TSA295TSG302ASA309GSG316CSG335CSA337T 1703.0 43 52 93 303 312 45.0;30 39 63 307 316 45.0 20 70 70 319 369 SA22CSC35GSA50CSA51T
80 112 0.00188346 CAGGTGCAACTTGTCCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGGCCTCAGTGAACATTTCCTGCAGGGCTTCTGGATTCACCTTCAGTGACCATCTTATAAATTGGGTGCGCCAAGTCCCCGGACAAAGCCTTGAGTGGATGGGTTGGATTAACCCTGACAATGGAAACACAAAATATTCACAGACGTTCCAGGGCAGAGTCACCATTTCCAGGCACTCATCCGCGAGCATAGTCTACGTGGAAGTGAGCGACCTGACATCTGAAGACACGGCTGTCTTTTACTGTGCGAGAGACATACTGTCCGTCGGCCCGCGCGCGAATGATGCTTTTGATGTCTGGGGCCAAGGGACCATGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(2076.5) IGHD4-1100(30),IGHD4-400(30),IGHD5-5*00(28) IGHJ3*00(452) nan 57 353 373 0 296 SC62GSG65ASG71CSA91GSG113CSG114ASA124GSA136TSC145GSA147GSG148AST150CSG153CSC154TSG158ASC159ASG173ASC175TSG188CSA203TSC209TSG213CSG217AST224ASA244CSA267TSG273CSA276TSC289TSC292TSA297GSG302ASC303GSA309GSG310ASG316CSG335CSA337T 1858.0 5 11 48 298 304 30.0;5 11 48 298 304 30.0;5 14 60 296 304 DG9 28.0
81 111 0.00186664 CAGGTTCAGTTGGTGCAGTCTGGAGCTGAGATGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCACCTACGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACTCACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACGTGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTCTATTACTGTGCGAGAGAGCATTTTCCCTCCACCTACGACAGCTTCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2947.2) IGHD5-1200(30),IGHD5-1800(30),IGHD2-15*00(29) IGHJ4*00(411) nan 57 353 373 0 296 SC66TSG87ASG148CST152CSA230TSA231CSA297GSG335C 2728.0 36 42 69 311 317 30.0;36 42 69 311 317 30.0;13 24 93 307 319 I18TST20G 29.0
82 110 0.00184983 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCACCTATGCTATCACCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGCTGGGAGGGATCATCCCTATCTTTGGTACAACAGACTACGCACGGAAGTTCCAGGGCAGAGTCACGATTACCGCGGCCGAATCCACGAGCACAGTCTTCATTGAACTGAGCAGCCTGACATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGAGTGGGAGCTTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2901.9) IGHD1-26*00(50) IGHJ4*00(490) nan 57 352 373 0 295 SG148CSG160CSA198CSG228ASA231GSA241GSA274CSC292TSA295TSG299TSG302ASG316C 2602.0 25 35 60 296 306 50.0 19 68 68 306 355 490.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCAGCACCTATGCT 40
83 110 0.00184983 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGCGCTAGTGGGAGCCTCCCTCGTCGGGGGTCGCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(3227.3) IGHD1-26*00(50) IGHJ6*00(530) nan 57 352 373 0 295 2950.0 24 34 60 298 308 50.0 30 83 83 326 379 530.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCAGCAGCTATGCT 40
84 110 0.00184983 CAGGTACAGTTGGTGCAGTCTGGGCCTCAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCACGGCTTCTGGAGGCACCTTCGGCAGGTATACTATCTCCTGGGTGCGACAGGCCCCTGGGCAGGGGCTTGAGTGGATGGGAGGGATCCTCCCTGTCCTTGGGAACACAAACGTCGCACAGAGATTCCAGGATAGACTCACATTTACCGCGGACGAATCCACGAGCACAGCCTACTTGGAACTGAGCAGCCTGAGACCTGAGGACACGGCCGTCTATTACTGTGCGCGAGGGTCCGTTGTTCTGACTGGGACAAACGCCCCCTTTGCCCACTGGGGCCAGGGAATCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2326.5) IGHD3-900(36),IGHD7-2700(31) IGHJ4*00(353) nan 57 352 373 0 295 SG62ASC66TSG81CSG84CSA124CSA144GSC149GSG153ASA159TSG160CSA182GSA185GSA210CSA216GST219CST224GSC226ASA227CSG228AST234GSA235TSA244GSG245ASG253ASC254TSG258CSG263ASA264TSA297TSG302AST318CSG335CSA348C 1993.0 42 52 93 304 314 ST44C 36.0;11 20 33 306 315 SA13G 31.0 24 68 68 326 370 SA29CST31CSC47T
85 110 0.00184983 GAGGTGCAGCTGCTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCGCCTGTGCAGCCTCTGGATTCTCCTTTAGTTCCTATGCCATGGTCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTAGTGCTAGAGGCGGGAGTTCATACTTCGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAATGTGCTGTCTCTGGAAATGAACAGCCTGAGAGCCGAGGACACGGCCACATATTTCTGTGCGAAAGGTTCTATCGAATATAGTGCCTCGGTTGACCACTGGGGCCAGGGAACCCTGGTCCTCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV3-23*00(2340.5) IGHD5-18*00(51) IGHJ4*00(333) nan 57 352 373 0 295 ST69CSG74AST117GSA138TSC146TSA147TSG148CSA159GSG160TSC205TSG214CST218AST221CST224GSC227TSA228TSA235TSC287TSA288GSC289TSA295CSC300GSG333AST334CSA340T 2225.0 25 38 69 303 316 SG35C 51.0 26 68 68 319 361 ST31CSA55CSC56T 333.0 nan GAGGTGCAGCTGCTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCGCCTGTGCAGCCTCT 40 GGATTCTCCTTTAGTTCCTATGCC 40
86 108 0.00181619 CAGGTTCTACTGGTGCAGTCCGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCCTCGGGTTACTCTTTCAGCACCTACGGTGTCAGCTGGGTGCGACAGGCCCCAGGACAAGGGCTTGAGTGGATGGGATGGCTCAACACTGGAGACGGTAACACAGCCTATGCACAGAAGCTCCAGGGCAGAATCACCTTGACCACAGACACATCCACGACAACAGCCTACATGGAACTGAGGAGCCTGAGATCTGACGACACGGCCATTTATTACTGTGCGAGAGGGGAGAACTATGGGTCGGCGAGGGACGTCTTTGACCACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2351.8) IGHD3-10*00(38) IGHJ4*00(411) nan 57 352 373 0 295 SA64TSG65AST77CST128CST131GSA138TSC140TST143CSC145GSG148CST152CSA156GST179ASA207CSG211ASG213AST216GSA217GSC218ASA219GST221CSA231GSA232CSG258ASA264TSG286CSC287ASG302ASG333ASG335T 2080.0 36 52 93 301 317 ST43GSA46GSG48C 38.0 24 68 68 323 367 ST31C 411.0 nan CAGGTTCTACTGGTGCAGTCCGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCCTCG 40 GGTTACTCTTTCAGCACCTACGGT 40
87 108 0.00181619 CAGGTGCAGCTGGTGCAGTCTGGTGTTGAGGTGAAGAAGCCTGGGTCCTCGGTGAGGGTCTCCTGCAAGGCTTCTGGAGACACCTTCAAGAACTCTGTTATTAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGACCATCCCTCTCTTTGGGACAACTGACTATGCCCAGAAGTTCCAGGGCAGACTCACAATTACGACGGACGAGTCTACGACTACAGCCTACATGGAAGTGAGTAGACTGACATCTGAGGACACGGCCGTTTATTACTGTGTGGCGGAACTGGACTTCGGGAAATTATCTGTCGTCTGGGGCCAGGGGACCACGGTCATCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2233.7) IGHD1-100(35),IGHD1-2000(35),IGHD1-7*00(35) IGHJ6*00(293) nan 57 346 373 0 289 SG80TSC82TSA112GSG136ASG145ASC146GSG148ASA151CSC154TSC158TST208CSA216CST224GSG228ASA230TSA231GSC236TSA239CSG258CSG263ASC269GSG270ASA278GSC281TSG286CSC287TSG302ASC303GSC308TSC311ASG316CSG335T 1962.0 22 29 51 295 302 35.0;22 29 51 295 302 35.0;22 29 51 295 302 35.0
88 108 0.00181619 CAGGTGCAGCTGGTGCAATCTGGGGCTGAGGTGAAGCAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCCTCTAGAGGCGCCCTCAGCAGCTATGCTATCACGTGGGTGCGACAGGCCCCTGGACAAGGGCTTGACTGGATGGGAAGGGTCATCCCTATCTATGGAACACCAAACTACGCGCAGAAGTTCCAGGGCAGACTCTCGCTTACCGTGGACGCATCCAAGAGCACAGCTTACTTGGAGCTGAGCGGCCTGAGATCTGAGGACACGGCCGTTTATTTCTGTGCGAGCGCGGGATCGCGAGAGATCAACCGCGGTGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2453.6) IGHD5-2400(30),IGHD7-2700(30) IGHJ3*00(470) nan 57 350 373 0 293 SG74ASA93CST128CSG132ASA138GST141CSG160CSC161GSG194CSG204ASA207GST220AST224ASG228CSA239GSG258CSA261TSA264CSC271TSA277CSC283ASC293TSA297TSA309GSG335TSA340T 2176.0 22 28 60 305 311 30.0;18 24 33 296 302 30.0 23 70 70 320 367
89 107 0.00179938 CAGGTGCAGTTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCCTCACAACCTTTTTTATGCACTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGAGTAATCAATCCTGGATATCCCGCTGGTAGAAGCACTACCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACTGACACGTCCACGAGCACAGTATACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGGGAGGCCATTGTAGCGGGAGCTACAACCGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCGTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-46*00(2708.3) IGHD1-26*00(52) IGHJ6*00(441) nan 57 353 373 0 305 SC66TSG86AST141CSC146ASG148CSA151TSC152TSA154TSG188CSA204GSC212TSA216GI218AI218TI218AI218TI218CI218CI218CI218GI218CSG222AST224ASA230TSG232CSG271CSG272TSC293ASC311GSG323CSA350G 2172.0 24 40 60 313 329 ST27CST37A 52.0 36 83 83 329 376 SC78G 441.0 nan CAGGTGCAGTTGGTGCAGTCTGGGGCTGAAGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCT 40 GGATACACCCTCACAACCTTTTTT 40
90 105 0.00176574 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCACCAACTATACTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATGTTTGGAACAACAAACCACGCACAGAAGTTCCAGGGCAGAGTCACGATTAACGCGAACAAATCCACGACCACAGCCCACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGATAGGCATTGGGTTACGATATTTTGACTGGCCATTTGAGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2851.8) IGHD3-9*00(90) IGHJ4*00(401) nan 57 352 373 0 295 SG145CSG148ASG153ASC218GST224ASG228AST234CSC268ASG273ASG276ASG286CST294CSG349T 2573.0 34 52 93 303 321 90.0 25 68 68 324 367 SC30G 401.0 nan CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCACCTTCACCAACTATACT 40
91 105 0.00176574 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTTAAGGTCTCCTGCACGGCTTCTGGATACACCTTCATCGACTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGGTGGATCAACCCTAGCAGTGGTGGCACACACTATGCACAGAAGTTTCAGGGCAGGGTCGCCATGACCAGGGACACGTCCATCAGCATAGTCTACATGGAGCTGAGCAGGCTGAAGTCTGACGACACGGCCATGTATTATTGTGCGAGAGATCGGGGATATGATTGTCCTGCCTCCTACTGCTACGCGTTATCCGGTCTGGACGTCTGGGGCCAAGGGACCAGGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-2*00(2834.3) IGHD2-1500(35),IGHD3-1600(35),IGHD6-19*00(35) IGHJ6*00(412) nan 57 355 373 0 298 SG110TSA124CSC145TSG148ASG188CSA203GSA217GSA231CST255ASA261GSC289TSC292TSG316ASA317GSG333ASC341T 2516.0 52 59 93 323 330 35.0;41 48 111 303 310 35.0;9 16 63 322 329 35.0
92 104 0.00174893 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCGGGGTACTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCACCTATGGTATCAACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGATACAACAAACTACGCACAGAAGTTCCAGGGCAAATTCACGATTACCGCGGACGAATCCACGAGCACAGTCTACATGGAGCTCAGTAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATGAGGCAGCAGCTGCCACGAGCGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2884.4) IGHD6-1300(50),IGHD2-1500(46) IGHJ6*00(470) nan 57 354 373 0 297 ST98GSC103ASG148CSC154GSG160ASG223ASG228ASG256ASG258TSC292TSG305CSC308T 2622.0 28 38 63 300 310 50.0;5 17 93 302 314 SA12G 46.0 36 83 83 317 364
93 103 0.00173211 CAGGTTCAGTTGGTGCAGTCTGGAACCGAGGTGAAGACGCCTGGGGCCTCAGTGAAGGTCTCCTGCCACGCCTCTGGTTACACCTTTACCAACTACGGTATCAACTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGCATGGATCAGCGCATACAATGGAAAGACACATCACGCACCGTTTGTCCAGGACAGAGTCACCATGACCACAGACACGTCGACGAGGACGGCCTACATGGAACTGACGAGCCTGAGATCTGACGACACGGCCGTCTATTACTGTGCGAGAGGAGGGTGGAACTACGGCCCTGGTCCTTTTGATTTGTGGGGCCAGGGGACAATGGTCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2310) IGHD1-7*00(50) IGHJ3*00(363) nan 57 352 373 0 295 SC66TSG81AST83CSA94CSA123CSG125CST128CSG148AST152CSG160ASG188CSG202CST215AST224ASC227GSA231CSC233TST234CST236CSA241CSA243TSA244TSG245TSC246GSG253ASA278GSC281GSC287GSA290GSG302ASG307CSG335C 2022.0 25 35 51 300 310 50.0 25 70 70 319 364 SA33TSC35GSA44G 363.0 nan CAGGTTCAGTTGGTGCAGTCTGGAACCGAGGTGAAGACGCCTGGGGCCTCAGTGAAGGTCTCCTGCCACGCCTCT 40 GGTTACACCTTTACCAACTACGGT 40
94 103 0.00173211 CAGGTCCAGCTTGTCCAGTCTGGGGCTGAGTTGAAGAAGCCTGGGGCCTCAGTGAACATCTCCTGCCAGGCTTCTGGATTCACCTTCAGTGACACTCTTATAAATTGGGTGCGCCAAGGCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACCCTGCCAATGGAAACACAAGATATTCAGAGTCGTTCCAGGGCAGAGTCACCATTTCCAGTCTCTCATCCGCGTCCACAGCCTACGTGGCGCTGAGCGACCTGACATCTGAGGACACGGCTGTTTATTACTGCGCGAGAGACATAGTGAGTGTCGGCCCGCGTGCGAATGATGCTTTTGATGTGTGGGGCCAAGGGACAATGATCACCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-3*00(1972.1) IGHD3-2200(33),IGHD3-1000(30),IGHD5-12*00(30) IGHJ3*00(423) nan 57 353 373 0 296 SG71CSG87TSG113CSG114AST116CSA123CSA136TSC145GSA147GSG148AST150ASA151CSG153CSC154TSG158ASC159ASG173ASC175GSG213CSG217CST224ASA232GSC240GSA243TSA244CSA267TSG272TSG273CSA274TSA276TSA285TSG286CSA297GSA301CSA309GSG310ASG316CSA323GSG335TST344C 1800.0 42 51 93 297 307 I47G 33.0;20 26 93 296 302 30.0;29 35 69 297 303 30.0
95 102 0.00171529 CAGGTGGAACTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCAACTTCATCACCTTTGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGCCTTGAGTGGATGGGAGAGATCATCCCTATCAGCAGTACAACAAAGTCCGCACATAAATTTCAGGACAGAGTCACGATTTCCGCGGACGGATCTTCGAGCACAGTCCACATGGAGCTGCGCAGCCTGAAATCCGAAGACACGGCCATTTATTTCTGTGCGAAAAAACTGGGGATCGACCCATTTGGGTCCTACGGTCTGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2288.7) IGHD7-27*00(55) IGHJ6*00(471) nan 57 349 373 0 292 SC63GSG65ASC139ASG145TSG148CSA151TSG188CSG205AST219AST220GST221CSG222ASG228ASC233GSA235CSG242TSG245ASC248TSG253ASA267TSA277GSC281TSA282TSC292TST294CSA306CSG316AST320CSG323ASG333ASG335TSA340T 1992.0 13 24 33 295 306 55.0 33 83 83 320 370 SA40C 471.0 nan CAGGTGGAACTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCT 40 GGAGGCAACTTCATCACCTTTGCT 40
96 100 0.00168166 CGGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAGGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCCTCTGGAGGCGACTTCAAAAACTTTATTATCGCCTGGGTGCGACAGGCCCCTGGACATGGGCTAGAGTGGATGGGAGGGGTCATCCCAATCTTTGGTACACCAAACTTCGTACAGAAGTTCCAGGACAGAGTCACGATCACCGCGGACGAAGCCACGAGTACCACCTACATGGAGCTGCGCAGCCTGAGATCTGAAGACACGGCCGTCTATTACTGTGCGAGAGTGGGGTCTTGTCTTAGTTCCAGCTGTCTCTACTACGGTATGGATGTCTGGGGCCAAGGGACCACGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-69D*00(2337.1) IGHD2-200(48),IGHD1-700(45),IGHD1-1*00(41) IGHJ6*00(472) nan 57 352 373 0 295 SA58GSA91GST128CSA138GSC139ASG145ASC146ASG148ASA151TSG153ASC154TSA159GSG160CSA185TST191ASA207GST215ASG228CSA235TSC238TSG253AST266CST279GSC287TSA290CSG291ASA306CSG323ASG335C 2109.0 37 55 93 302 320 SA41CSG42TSA47T 48.0;1 10 51 308 317 45.0;3 14 51 310 321 ST10C 41.0
97 100 0.00168166 CAGGTTCAGCTGGTGCAGTCTGGAGTAGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTCCCAACTACGGTATCAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAGACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGACCACAGCCTACATGGAGGTAACGAACCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGACGTTATCCCCTATTGTGGAAGTGACTGCTACCCGGGGTACTTCCACCACTGGGGCCAGGGCACCCTGGTCATCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-18*00(2799.5) IGHD2-21*00(58) IGHJ1*00(402) nan 57 353 373 0 296 SC82TST83ASA144CSG148AST152CSG160ASC161TSA231GSG286CSC303GSG305ASG307CSG310A 2583.0 32 52 84 306 326 ST40ASG41AST46C 58.0 26 72 72 333 379 SG34CSC60T 402.0 nan CAGGTTCAGCTGGTGCAGTCTGGAGTAGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCT 40 GGTTACACCTTTCCCAACTACGGT 40
98 99 0.00166484 CAGGTGCACCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCATGGCTTCTGGATACAACTTCATCGCCCAGAATATACACTGGGTGCGACAGGCCCCTGGACTAGGCCTTGAGTGGATGGGAAAGATGAACCCTAACAGTGGTGGCTCCGACTATGCACAGGAGTTTCAGGGCAGGGTCACCGTGACCAGAGACACGTCCATCTCTACAGTCTACATGGAGTTGACCAGCCTAAAATCTGACGACACGGCCGTTTATTACTGTGCCCGCGAGCGACACTTGAACTCCCCGTCTGACGCTTTTGATCTCTGGGGCCAAGGGACAATGGTCATCGTCTCTTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV1-2*00(2427.1) IGHD3-1600(40),IGHD3-1000(35) IGHJ3*00(413) nan 57 347 373 0 290 SG65CSA124TSC139ASC145TSG148CST150CSC152GST153ASG158ASA184TSG188CST204ASG205ASC209GSA228TSA230CSA231GSA243GST255ASA264GSG272ASA285TSG286CSC287TSC292TSC303TSG307CSG311CSG314ASG316ASG335T 2001.0 11 19 111 306 314 40.0;8 15 93 306 313 35.0 20 70 70 317 367 ST23CSA33CSC58T
99 99 0.00166484 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGGGACCGTGTCCCTCACCTGCGCTGTGTCTGGTGTCTCCATAAGCAGTGATAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGCGCTGGAGTGGATTGGGGAAATCCATCATAGTGGGAGTACCAACTACAACCCTTCCCTCAAGAGTCGAGTCACCATGTCAGTTGTCCCGTCCAAGGACCTGTTCTCCCTGACCCTGAACTCTGTGACCGCCGCGGACACGGCCTTCTATTACTGTGCGAGAGATCAGGGCAGCCACCCCGGCGATTGGGGCCAGGGAACCCTGGTCTCCGTCTCCTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IGHV4-4*00(2810.4) IGHD6-1900(35),IGHD2-1500(31),IGHD5-12*00(30) IGHJ400(311),IGHJ500(311) nan 57 355 373 0 298 SA94GSC108GSC128GSG136TSC143ASA150GSG151ASG190CST213CSC227TSG242TSA266GSA272TSA274TSA276CSA277CSA285GSA289TSA301CSG302CSG307ASG333TSG335C 2313.0 4 11 63 302 309 35.0;6 15 93 301 310 ST11C 31.0;8 14 69 303 309 30.0

Quality control

Now when we have processed all samples, we can proceed to quality control. First thing that we want to look at is the alignment quality. This can be easily done with the following command:

mixcr exportQc align results/*.clns figs/alignQc.pdf

alignQc.svg

From the plot above we see that most samples have high percentage of successfully aligned reads (above 90%). What we can also tell is that from all the samples those that come from HIP1_female_IgG4 have a lower alignment rate:

  • SRR8365486_HIP1_female_IgG4
  • SRR8365430_HIP1_female_IgG4
  • SRR8365394_HIP1_female_IgG4
  • SRR8365317_HIP1_female_IgG4
  • SRR8365280_HIP1_female_IgG4

That suggest a potential issue during sample preparation. Note that HIP3_male_IgG4 and HIP3_male_IgG3 sample also tend to have a lower alignment rate.

Let's look at the same plot, but instead of percentages of reads we will plot an absolute number of reads.

mixcr exportQc align --absolute-values results/*.clns figs/alignQcAbsolute.pdf

alignQc.svg

The plot shows that nearly all bad samples have significantly lower total reads count. Next, lets take a closer look at SRR8365280_HIP1_female_IgG4. This sample has quite a bit of reads but most of them lack Ig sequences. By default, MiXCR removed non target reads during alignment. We will realign this sample using options -OallowPartialAlignments=true and -OallowNoCDR3PartAlignments=true to preserve partially aligned reads. We will also save not aligned reads (--not-aligned-R1, --not-aligned-R2) to separate FASTQ files for manual inspection. See mixcr align for more details.

Bellow is the complete command:

mkdir -p debug
mixcr align -f \
    --species hsa \
    -p kAligner2_4.0 \
    -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \
    -OvParameters.parameters.floatingLeftBound=true \
    -OjParameters.parameters.floatingRightBound=false \
    -OallowNoCDR3PartAlignments=true \
    -OallowPartialAlignments=true \
    --not-aligned-R1 debug/SRR8365280_HIP1_female_IgG4_notAligned_R1.fastq \
    --not-aligned-R2 debug/SRR8365280_HIP1_female_IgG4_notAligned_R2.fastq \
    -r debug/SRR8365280_HIP1_female_IgG4_debug.report \
     raw/SRR8365280_HIP1_female_IgG4_R1.fastq.gz raw/SRR8365280_HIP1_female_IgG4_R2.fastq.gz \
     debug/SRR8365280_HIP1_female_IgG4_debug.vdjca

Resulting SRR8365280_HIP1_female_IgG4_notAligned_R1.fastq and SRR8365280_HIP1_female_IgG4_notAligned_R1.fastq files can be manually inspected. A brief BLAST search revealed that a lot of reads align with PhiX, which is regularly used as a DNA sequencing control in Illumina protocol. Bellow you can see a few reads from SRR8365280_HIP1_female_IgG4_notAligned_R2.fastq.

@SRR8365280.116 GWZHISEQ01:570:HYJYKBCXX:1:1101:12039:44077/2
GAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGC
+
DDBDD<GHHIFHIHIIIEHIGGIIIIIIGHIIIICHIIIIIHEHHHHDHIICHHHIIIIIIIIIIIGDHIIFHIIIIIGIIIIIHIHHIHIIHIIHHIIIIHIIIIIIIIIIIIIGIIIIHIIIIEHHIIHHHGIIIIIIIIIIIIIHIIIHIHHIIIIIIHIIIII=FHHIFHCGHG?HIIIIGIIIIEHCFHHII?GHH.FHEHIIHHHH-BGHHHHGFHIIIHI.5B6-8@F-B@HHHHIIIIGFE?-
@SRR8365280.117 GWZHISEQ01:570:HYJYKBCXX:1:1101:13143:44082/2
ACGATGAGGGACATAAAAAGTAAAAATGTCTACAGTAGAGTCAATAGCAAGGCCACGACGCAATGGAGAAAGACGGAGAGCGCCAACGGCGTCCATCTCGAAGGAGTCGCCAGCGATAACCGGAGTAGTTGAAATGGTAATAAGACGACCAATCTGACCAGCAAGGAAGCCAAGATGGGAAAGGTCATGCGGCATACGCTCGGCGCCAGTTTGAATATTAGACATAATTTATCCTCAAGTAAGGGGCCGAA
+
DDDDBIIIIIHHGHHIHHHIIIFIGIHHIIHHIIIIIHHIHIIIIEHHHGIIIIIIIIIHHIIIIIIHIIIFHIHIIIIIHGHIIIIHIIIIIHIHIIIIIDGHHHHIGIIHIIIIIIIIIGHIHGHHHHHIHIIEHIIII@HHIIIIIIIHIHIIHHIHIHIIIIIHIIII.BEGHGII?FHGHFHHHCDHIIIIHHCEHHIHIGIIIAHGEEEHH?FH?AFFHFHHHHH?FCH--BHHHHHE@,,>??H
@SRR8365280.118 GWZHISEQ01:570:HYJYKBCXX:1:1101:9938:44446/2
AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCATCT
+
DDDDDIIGIIIIIIHGHHHHHHHIIIIHIF?HHIII?FHIIHIIIEHFHHIIIIIIIIHIIIIIIHIIIHIIIIIIIIIIIIIIIIIGIIIIIIIIHHHIHHHHIIIIHIIIIIIIHIIIHIIHIGIICGHCHHIHHGEEEEHIIIIIIIIIIIGHIIIIIIIIHIIICE<CHIIHHIIHIHIIIIFHIIIIIIHHEGEHHAFEECHIGHIIIIIG?E?EEH?CHGIGHII?GHIDDHHHIIIHEHEFB-A

Now lets look inside SRR8365280_HIP1_female_IgG4_debug.vdjca file witch now has partially aligned reads in it. That can be easily achieved using mixcr exportAlignmentsPretty.

The function bellow will generate a .txt human-readable file with alignments. We use parameter --skip 1000 to skip first 1000 reads, as first reads usually have bad quality, and --limit 100 will export only 100 alignments.

mixcr exportAlignmentsPretty
    --skip 1000 \
    --limit 100 \
    debug/SRR8365280_HIP1_female_IgG4_debug.vdjca \
    SRR8365280_HIP1_female_IgG4_debug.alignments.txt

Bellow you can see one of the alignments. First read aligns with a good score to IGHV1-69D. But its pair consists of low-quality nucleotides and can't be aligned against ahy IGHJ.

Further analysis might help reveal where such low quality reads come from.

>>> Read ids: 12846


                                                L1><L2     L2><FR1
                _ T  R  F  L  F  V  V  A  A  A  T  G  V  Q  S  Q  V  Q  L  V  Q  S  G  P  E  V
     Quality    76767888777877765777666775777788877737576737677788888767777778357777767777667877
     Target0  0 CACTAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGCCTGAGGTGA 79  Score
IGHV1-69D*00 11 cTGGaggttcctctttgtggtggcagcagctacaggtgtccagtcccaggtgcagctggtgcagtctgggGctgaggtga 90  1901

                                                     FR1><CDR1              CDR1><FR2
                K  K  P  G  S  S  V  K  V  S  C  E  A  S  G  G  T  F  S  N  F  A  V  N  W  V  R
     Quality    87888877888677675673763577787777777786767777776667878888888773577677878867775677
     Target0 80 AGAAGCCTGGGTCGTCGGTGAAGGTCTCCTGCGAGGCTTCTGGAGGCACCTTCAGTAACTTTGCTGTCAACTGGGTGCGA 159  Score
IGHV1-69D*00 91 agaagcctgggtcCtcggtgaaggtctcctgcAaggcttctggaggcaccttcagCaGctAtgctAtcaGctgggtgcga 170  1901

                                                 FR2><CDR2              CDR2><FR3
                  Q  A  P  G  Q  G  L  E  W  V  G  G  I  I  P  L  F  N  V  A  K  Y  A  Q  K  F  E
     Quality     77787778865577867376625733535577887777787767786772253677767777677777787777766667
     Target0 160 CAGGCCCCTGGACAAGGGCTTGAGTGGGTGGGAGGGATCATCCCTCTATTTAATGTGGCAAAGTACGCACAGAAGTTCGA 239  Score
IGHV1-69D*00 171 caggcccctggacaagggcttgagtggAtgggagggatcatccctAtCtttGGtACAgcaaaCtacgcacagaagttcCa 250  1901


                   G  R  V _
     Quality     76677566676
     Target0 240 GGGCAGAGTCA 250  Score
IGHV1-69D*00 251 gggcagagtca 261  1901


Quality   26426422222222222562442222424424255222225225222225224226522255252272242277525257
Target1 0 GGTTGGTTGGCGGGCTCATCCCGCTATTTAATGTGGGGATGTACGCACTGAGGTACGTTGGCAGGGTCCCGGTTGTCGCG 79  Score


Quality    72737277523535532353332333335333222235526353536262252522222577533555352225673735
Target1 80 GACGATTCAGTGGGCTGTGCTTACGTAGACATTGCCCGCTTGCGATCTGCCGCCAGCGCCGTGTATTACTGTGCGGCTTC 159  Score


Quality     53333223353333655367555355333325223333535353355335367777733353335333333533533533
Target1 160 AGGTGGCGACGTCCTGTGATATGACTACAAGGCCCCCTAAGGGGATGAACTATGGGGGCAATCGACAATAGTGACCGTCT 239  Score


Quality     33533233333
Target1 240 ACTAAGTTTCG 250  Score

Finally, lets check chain usage among all samples.

mixcr exportQc chainUsage results/*.clns figs/chainUsage.pdf

chainUsage.svg

The plot suggests that this data has a low cross-contamination level, since almost all clones from IgG1, IgG2,IgG3,IgG4,IgM and IgA samples are IGH, and samples with IgK and IgL mostly consist of IGK and IGL clones.

Full-length clonotype assembly

ABhelix BCR protocol allows to recover a broader BCR receptor sequence then just CDR3 region. According to the protocol, forward primers are located in the leader region, thus we can safely use an assembling feature that starts from FR1 and be sure that no primers will affect the original sequence. The reverse primers are located in C gene region close to FR4End.

Taking into account what is mentioned above, the longest possible assembling feature for this protocol is "{FR1Begin:FR4End}".

MiXCR has a specific preset to obtain full-length BCR clones with ABhelix protocol:

mixcr analyze abhelix-human-bcr-full-length\
    raw/SRR8365277_HIP1_female_IgG1_R1.fastq.gz \
    raw/SRR8365277_HIP1_female_IgG1_R2.fastq.gz \
    results/SRR8365277_HIP1_female_IgG1.vdjca

The mixcr assemble step in this preset differs from the one above in the following manner:

--8<-- "abhelix-bcr/scripts/140-upstream-assemble-full-length.sh
-OassemblingFeatures="{FR1Begin:FR4End}"
sets the assembling feature to the region which starts from FR1Begin and ends at the end of FR4.

Notice that we do not use -OseparateByV=true and -OseparateByJ=true in this case because assembling feature already covers full V and J sequences, thus in case if clones have identical CDR3 they will still be separated.

Reports

Finally, MiXCR provides a very convenient way to look at the reports generated at ech step. Every .vdjca, .clns and .clna file holds all the reports for every MiXCR function that has been applied to this sample. E.g. in our case .clns file contains reports for mixcr align and mixcr assemble. To output this report use mixcr exportReports as shown bellow. Note --json parameter will output a JSON-formatted report.

mixcr exportReports \
    results/SRR8365277_HIP1_female_IgG1.clns \
    results/SRR8365277_HIP1_female_IgG1.report.txt
mixcr exportReports \
    --json \
    results/SRR8365277_HIP1_female_IgG1.clns \
    results/SRR8365277_HIP1_female_IgG1.report.json
Show report file
============== Align Report ==============
Input file(s): /raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R1.fastq.gz,/raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R2.fastq.gz
Output file(s): results/SRR8365277_HIP1_female_IgG1.vdjca
Version: 4.0.0-306-develop; built=Fri Sep 23 00:05:26 CEST 2022; rev=f7972131fd; lib=repseqio.v2.0
Command line arguments: align --species hsa -n 100000 -p kAligner2_4.0 -OvParameters.geneFeatureToAlign=VTranscriptWithout5UTRWithP -OvParameters.parameters.floatingLeftBound=false -OjParameters.parameters.floatingRightBound=true --report results/SRR8365277_HIP1_female_IgG1.report.txt --json-report results/SRR8365277_HIP1_female_IgG1.report.json /raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R1.fastq.gz /raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R2.fastq.gz results/SRR8365277_HIP1_female_IgG1.vdjca
Analysis time: 0ns
Total sequencing reads: 100000
Successfully aligned reads: 96116 (96.12%)
Paired-end alignment conflicts eliminated: 4965 (4.96%)
Alignment failed, no hits (not TCR/IG?): 2056 (2.06%)
Alignment failed because of absence of V hits: 5 (0.01%)
Alignment failed because of absence of J hits: 1483 (1.48%)
No target with both V and J alignments: 340 (0.34%)
Overlapped: 93602 (93.6%)
Overlapped and aligned: 90679 (90.68%)
Alignment-aided overlaps: 1473 (1.62%)
Overlapped and not aligned: 2923 (2.92%)
No CDR3 parts alignments, percent of successfully aligned: 37 (0.04%)
Partial aligned reads, percent of successfully aligned: 840 (0.87%)
V gene chimeras: 93 (0.09%)
TRB chains: 1 (0%)
TRB non-functional: 0 (0%)
IGH chains: 96115 (100%)
IGH non-functional: 1190 (1.24%)
Realigned with forced non-floating bound: 15742 (15.74%)
Realigned with forced non-floating right bound in left read: 2751 (2.75%)
Realigned with forced non-floating left bound in right read: 2751 (2.75%)
============== Assemble Report ==============
Input file(s): results/SRR8365277_HIP1_female_IgG1.vdjca
Output file(s): results/SRR8365277_HIP1_female_IgG1.clns
Version: 4.0.0-306-develop; built=Fri Sep 23 00:05:26 CEST 2022; rev=f7972131fd; lib=repseqio.v2.0
Command line arguments: assemble -f -OassemblingFeatures={FR1Begin:FR4End} --report results/SRR8365277_HIP1_female_IgG1.report.txt --json-report results/SRR8365277_HIP1_female_IgG1.report.json results/SRR8365277_HIP1_female_IgG1.vdjca results/SRR8365277_HIP1_female_IgG1.clns
Analysis time: 0ns
Final clonotype count: 7035
Average number of reads per clonotype: 8.45
Reads used in clonotypes, percent of total: 59465 (59.47%)
Reads used in clonotypes before clustering, percent of total: 61595 (61.59%)
Number of reads used as a core, percent of used: 57233 (92.92%)
Mapped low quality reads, percent of used: 4362 (7.08%)
Reads clustered in PCR error correction, percent of used: 2130 (3.46%)
Reads pre-clustered due to the similar VJC-lists, percent of used: 0 (0%)
Reads dropped due to the lack of a clone sequence, percent of total: 17978 (17.98%)
Reads dropped due to a too short clonal sequence, percent of total: 0 (0%)
Reads dropped due to low quality, percent of total: 0 (0%)
Reads dropped due to failed mapping, percent of total: 16543 (16.54%)
Reads dropped with low quality clones, percent of total: 0 (0%)
Clonotypes eliminated by PCR error correction: 1682
Clonotypes dropped as low quality: 0
Clonotypes pre-clustered due to the similar VJC-lists: 0
IGH chains: 7035 (100%)
IGH non-functional: 65 (0.92%)
{
  "type": "alignerReport",
  "commandLine": "align --species hsa -n 100000 -p kAligner2_4.0 -OvParameters.geneFeatureToAlign=VTranscriptWithout5UTRWithP -OvParameters.parameters.floatingLeftBound=false -OjParameters.parameters.floatingRightBound=true --report results/SRR8365277_HIP1_female_IgG1.report.txt --json-report results/SRR8365277_HIP1_female_IgG1.report.json /raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R1.fastq.gz /raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R2.fastq.gz results/SRR8365277_HIP1_female_IgG1.vdjca",
  "inputFiles": [
    "/raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R1.fastq.gz",
    "/raw/PRJNA511481-HIP/ABHelix_BCR/SRR8365277_HIP1_female_IgG1_R2.fastq.gz"
  ],
  "outputFiles": [
    "results/SRR8365277_HIP1_female_IgG1.vdjca"
  ],
  "version": "4.0.0-306-develop; built=Fri Sep 23 00:05:26 CEST 2022; rev=f7972131fd; lib=repseqio.v2.0",
  "trimmingReport": null,
  "totalReadsProcessed": 100000,
  "aligned": 96116,
  "notAligned": 3884,
  "notAlignedReasons": {
    "NoCDR3Parts": 0,
    "NoJHits": 1483,
    "VAndJOnDifferentTargets": 340,
    "NoHits": 2056,
    "LowTotalScore": 0,
    "NoVHits": 5,
    "NoBarcode": 0
  },
  "chimeras": 0,
  "overlapped": 93602,
  "alignmentAidedOverlaps": 1473,
  "overlappedAligned": 90679,
  "overlappedNotAligned": 2923,
  "pairedEndAlignmentConflicts": 4965,
  "vChimeras": 93,
  "jChimeras": 0,
  "chainUsage": {
    "type": "chainUsage",
    "chimeras": 0,
    "total": 96116,
    "chains": {
      "TRB": {
        "total": 1,
        "nonFunctional": 0,
        "isOOF": 0,
        "hasStops": 0
      },
      "IGH": {
        "total": 96115,
        "nonFunctional": 1190,
        "isOOF": 653,
        "hasStops": 537
      }
    }
  },
  "realignedWithForcedNonFloatingBound": 15742,
  "realignedWithForcedNonFloatingRightBoundInLeftRead": 2751,
  "realignedWithForcedNonFloatingLeftBoundInRightRead": 2751,
  "noCDR3PartsAlignments": 37,
  "partialAlignments": 840,
  "tagReport": null
}
{
  "type": "assemblerReport",
  "commandLine": "assemble -f -OassemblingFeatures={FR1Begin:FR4End} --report results/SRR8365277_HIP1_female_IgG1.report.txt --json-report results/SRR8365277_HIP1_female_IgG1.report.json results/SRR8365277_HIP1_female_IgG1.vdjca results/SRR8365277_HIP1_female_IgG1.clns",
  "inputFiles": [
    "results/SRR8365277_HIP1_female_IgG1.vdjca"
  ],
  "outputFiles": [
    "results/SRR8365277_HIP1_female_IgG1.clns"
  ],
  "version": "4.0.0-306-develop; built=Fri Sep 23 00:05:26 CEST 2022; rev=f7972131fd; lib=repseqio.v2.0",
  "preCloneAssemblerReport": null,
  "totalReadsProcessed": 100000,
  "initialClonesCreated": 8717,
  "readsDroppedNoTargetSequence": 17978,
  "readsDroppedTooShortClonalSequence": 0,
  "readsDroppedLowQuality": 0,
  "coreReads": 57233,
  "readsDroppedFailedMapping": 16543,
  "lowQualityRescued": 4362,
  "clonesClustered": 1682,
  "readsClustered": 2130,
  "clones": 7035,
  "clonesDroppedAsLowQuality": 0,
  "clonesPreClustered": 0,
  "readsPreClustered": 0,
  "readsInClones": 59465,
  "readsInClonesBeforeClustering": 61595,
  "readsDroppedWithLowQualityClones": 0,
  "clonalChainUsage": {
    "type": "chainUsage",
    "chimeras": 0,
    "total": 7035,
    "chains": {
      "IGH": {
        "total": 7035,
        "nonFunctional": 65,
        "isOOF": 55,
        "hasStops": 10
      }
    }
  }
}