Skip to content

Analysis of TCR amplicon libraries with UMIs

Data libraries

This tutorial uses the data from the publication: Simon S, Voillet V, Vignard V, et al, PD-1 and TIGIT coexpression identifies a circulating CD8 T cell subset predictive of response to anti-PD-1 therapy, Journal for ImmunoTherapy of Cancer 2020;8:e001631. doi: 10.1136/jitc-2020-001631

The data was collected from 12 patients. PBMC samples were obtained at three time points for each patient. The libraries were generated using Human TCR Panel QIAseq Immune Repertoire RNA Library Kit (QIAGEN™). Sequencing was performed using Illumina NextSeq™ sequencing machine. Each samples contain sequences of TCRα and TCRβ chains enriched cDNA libraries of human. 261bp Read 1 holds CDR3 region and 41bp Read 2 with UMI (first 12bp):

All data may be downloaded directly from SRA using e.g. SRA Explorer.

Use aria2c for efficient download of the full dataset with the proper filenames:

download.sh
mkdir -p raw
aria2c -c -s 16 -x 16 -k 1M -j 8 -i download-list.txt
download-list.txt
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545823/SRR10545823_1.fastq.gz 
  out=raw/SRR10545823_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545823/SRR10545823_2.fastq.gz 
  out=raw/SRR10545823_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545498/SRR10545498_1.fastq.gz 
  out=raw/SRR10545498_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545498/SRR10545498_2.fastq.gz 
  out=raw/SRR10545498_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545497/SRR10545497_1.fastq.gz 
  out=raw/SRR10545497_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545497/SRR10545497_2.fastq.gz 
  out=raw/SRR10545497_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545504/SRR10545504_1.fastq.gz 
  out=raw/SRR10545504_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545504/SRR10545504_2.fastq.gz 
  out=raw/SRR10545504_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545503/SRR10545503_1.fastq.gz 
  out=raw/SRR10545503_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545503/SRR10545503_2.fastq.gz 
  out=raw/SRR10545503_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545499/SRR10545499_1.fastq.gz 
  out=raw/SRR10545499_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545499/SRR10545499_2.fastq.gz 
  out=raw/SRR10545499_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545824/SRR10545824_1.fastq.gz 
  out=raw/SRR10545824_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545824/SRR10545824_2.fastq.gz 
  out=raw/SRR10545824_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545825/SRR10545825_1.fastq.gz 
  out=raw/SRR10545825_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545825/SRR10545825_2.fastq.gz 
  out=raw/SRR10545825_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545505/SRR10545505_1.fastq.gz 
  out=raw/SRR10545505_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545505/SRR10545505_2.fastq.gz 
  out=raw/SRR10545505_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545688/SRR10545688_1.fastq.gz 
  out=raw/SRR10545688_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545688/SRR10545688_2.fastq.gz 
  out=raw/SRR10545688_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545687/SRR10545687_1.fastq.gz 
  out=raw/SRR10545687_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545687/SRR10545687_2.fastq.gz 
  out=raw/SRR10545687_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545686/SRR10545686_1.fastq.gz 
  out=raw/SRR10545686_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545686/SRR10545686_2.fastq.gz 
  out=raw/SRR10545686_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545502/SRR10545502_1.fastq.gz 
  out=raw/SRR10545502_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545502/SRR10545502_2.fastq.gz 
  out=raw/SRR10545502_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545500/SRR10545500_1.fastq.gz 
  out=raw/SRR10545500_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545500/SRR10545500_2.fastq.gz 
  out=raw/SRR10545500_GSM4195404_TCR-seq_P5-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545501/SRR10545501_1.fastq.gz 
  out=raw/SRR10545501_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545501/SRR10545501_2.fastq.gz 
  out=raw/SRR10545501_GSM4195405_TCR-seq_P5-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545685/SRR10545685_1.fastq.gz 
  out=raw/SRR10545685_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545685/SRR10545685_2.fastq.gz 
  out=raw/SRR10545685_GSM4195451_TCR-seq_P14-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545684/SRR10545684_1.fastq.gz 
  out=raw/SRR10545684_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545684/SRR10545684_2.fastq.gz 
  out=raw/SRR10545684_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545506/SRR10545506_1.fastq.gz 
  out=raw/SRR10545506_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545506/SRR10545506_2.fastq.gz 
  out=raw/SRR10545506_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545507/SRR10545507_1.fastq.gz 
  out=raw/SRR10545507_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545507/SRR10545507_2.fastq.gz 
  out=raw/SRR10545507_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545683/SRR10545683_1.fastq.gz 
  out=raw/SRR10545683_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545683/SRR10545683_2.fastq.gz 
  out=raw/SRR10545683_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545508/SRR10545508_1.fastq.gz 
  out=raw/SRR10545508_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545508/SRR10545508_2.fastq.gz 
  out=raw/SRR10545508_GSM4195406_TCR-seq_P5-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545509/SRR10545509_1.fastq.gz 
  out=raw/SRR10545509_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545509/SRR10545509_2.fastq.gz 
  out=raw/SRR10545509_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545682/SRR10545682_1.fastq.gz 
  out=raw/SRR10545682_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545682/SRR10545682_2.fastq.gz 
  out=raw/SRR10545682_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545681/SRR10545681_1.fastq.gz 
  out=raw/SRR10545681_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545681/SRR10545681_2.fastq.gz 
  out=raw/SRR10545681_GSM4195450_TCR-seq_P14-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545680/SRR10545680_1.fastq.gz 
  out=raw/SRR10545680_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545680/SRR10545680_2.fastq.gz 
  out=raw/SRR10545680_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545510/SRR10545510_1.fastq.gz 
  out=raw/SRR10545510_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545510/SRR10545510_2.fastq.gz 
  out=raw/SRR10545510_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545511/SRR10545511_1.fastq.gz 
  out=raw/SRR10545511_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545511/SRR10545511_2.fastq.gz 
  out=raw/SRR10545511_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545512/SRR10545512_1.fastq.gz 
  out=raw/SRR10545512_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545512/SRR10545512_2.fastq.gz 
  out=raw/SRR10545512_GSM4195407_TCR-seq_P5-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545679/SRR10545679_1.fastq.gz 
  out=raw/SRR10545679_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545679/SRR10545679_2.fastq.gz 
  out=raw/SRR10545679_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545513/SRR10545513_1.fastq.gz 
  out=raw/SRR10545513_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545513/SRR10545513_2.fastq.gz 
  out=raw/SRR10545513_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545678/SRR10545678_1.fastq.gz 
  out=raw/SRR10545678_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545678/SRR10545678_2.fastq.gz 
  out=raw/SRR10545678_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545514/SRR10545514_1.fastq.gz 
  out=raw/SRR10545514_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545514/SRR10545514_2.fastq.gz 
  out=raw/SRR10545514_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545515/SRR10545515_1.fastq.gz 
  out=raw/SRR10545515_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545515/SRR10545515_2.fastq.gz 
  out=raw/SRR10545515_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545676/SRR10545676_1.fastq.gz 
  out=raw/SRR10545676_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545676/SRR10545676_2.fastq.gz 
  out=raw/SRR10545676_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545677/SRR10545677_1.fastq.gz 
  out=raw/SRR10545677_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545677/SRR10545677_2.fastq.gz 
  out=raw/SRR10545677_GSM4195449_TCR-seq_P14-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545675/SRR10545675_1.fastq.gz 
  out=raw/SRR10545675_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545675/SRR10545675_2.fastq.gz 
  out=raw/SRR10545675_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545674/SRR10545674_1.fastq.gz 
  out=raw/SRR10545674_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545674/SRR10545674_2.fastq.gz 
  out=raw/SRR10545674_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545516/SRR10545516_1.fastq.gz 
  out=raw/SRR10545516_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545516/SRR10545516_2.fastq.gz 
  out=raw/SRR10545516_GSM4195408_TCR-seq_P5-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545517/SRR10545517_1.fastq.gz 
  out=raw/SRR10545517_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545517/SRR10545517_2.fastq.gz 
  out=raw/SRR10545517_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545672/SRR10545672_1.fastq.gz 
  out=raw/SRR10545672_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545672/SRR10545672_2.fastq.gz 
  out=raw/SRR10545672_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545673/SRR10545673_1.fastq.gz 
  out=raw/SRR10545673_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545673/SRR10545673_2.fastq.gz 
  out=raw/SRR10545673_GSM4195448_TCR-seq_P14-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545518/SRR10545518_1.fastq.gz 
  out=raw/SRR10545518_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545518/SRR10545518_2.fastq.gz 
  out=raw/SRR10545518_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545671/SRR10545671_1.fastq.gz 
  out=raw/SRR10545671_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545671/SRR10545671_2.fastq.gz 
  out=raw/SRR10545671_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545519/SRR10545519_1.fastq.gz 
  out=raw/SRR10545519_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545519/SRR10545519_2.fastq.gz 
  out=raw/SRR10545519_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545520/SRR10545520_1.fastq.gz 
  out=raw/SRR10545520_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545520/SRR10545520_2.fastq.gz 
  out=raw/SRR10545520_GSM4195409_TCR-seq_P5-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545670/SRR10545670_1.fastq.gz 
  out=raw/SRR10545670_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545670/SRR10545670_2.fastq.gz 
  out=raw/SRR10545670_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545521/SRR10545521_1.fastq.gz 
  out=raw/SRR10545521_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545521/SRR10545521_2.fastq.gz 
  out=raw/SRR10545521_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545522/SRR10545522_1.fastq.gz 
  out=raw/SRR10545522_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545522/SRR10545522_2.fastq.gz 
  out=raw/SRR10545522_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545669/SRR10545669_1.fastq.gz 
  out=raw/SRR10545669_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545669/SRR10545669_2.fastq.gz 
  out=raw/SRR10545669_GSM4195447_TCR-seq_P8-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545668/SRR10545668_1.fastq.gz 
  out=raw/SRR10545668_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545668/SRR10545668_2.fastq.gz 
  out=raw/SRR10545668_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545667/SRR10545667_1.fastq.gz 
  out=raw/SRR10545667_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545667/SRR10545667_2.fastq.gz 
  out=raw/SRR10545667_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545666/SRR10545666_1.fastq.gz 
  out=raw/SRR10545666_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545666/SRR10545666_2.fastq.gz 
  out=raw/SRR10545666_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545524/SRR10545524_1.fastq.gz 
  out=raw/SRR10545524_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545524/SRR10545524_2.fastq.gz 
  out=raw/SRR10545524_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545523/SRR10545523_1.fastq.gz 
  out=raw/SRR10545523_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545523/SRR10545523_2.fastq.gz 
  out=raw/SRR10545523_GSM4195410_TCR-seq_P5-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545525/SRR10545525_1.fastq.gz 
  out=raw/SRR10545525_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545525/SRR10545525_2.fastq.gz 
  out=raw/SRR10545525_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545665/SRR10545665_1.fastq.gz 
  out=raw/SRR10545665_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545665/SRR10545665_2.fastq.gz 
  out=raw/SRR10545665_GSM4195446_TCR-seq_P8-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545526/SRR10545526_1.fastq.gz 
  out=raw/SRR10545526_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545526/SRR10545526_2.fastq.gz 
  out=raw/SRR10545526_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545664/SRR10545664_1.fastq.gz 
  out=raw/SRR10545664_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545664/SRR10545664_2.fastq.gz 
  out=raw/SRR10545664_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545527/SRR10545527_1.fastq.gz 
  out=raw/SRR10545527_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545527/SRR10545527_2.fastq.gz 
  out=raw/SRR10545527_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545663/SRR10545663_1.fastq.gz 
  out=raw/SRR10545663_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545663/SRR10545663_2.fastq.gz 
  out=raw/SRR10545663_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545662/SRR10545662_1.fastq.gz 
  out=raw/SRR10545662_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545662/SRR10545662_2.fastq.gz 
  out=raw/SRR10545662_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545528/SRR10545528_1.fastq.gz 
  out=raw/SRR10545528_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545528/SRR10545528_2.fastq.gz 
  out=raw/SRR10545528_GSM4195411_TCR-seq_P5-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545529/SRR10545529_1.fastq.gz 
  out=raw/SRR10545529_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545529/SRR10545529_2.fastq.gz 
  out=raw/SRR10545529_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545661/SRR10545661_1.fastq.gz 
  out=raw/SRR10545661_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545661/SRR10545661_2.fastq.gz 
  out=raw/SRR10545661_GSM4195445_TCR-seq_P8-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545530/SRR10545530_1.fastq.gz 
  out=raw/SRR10545530_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545530/SRR10545530_2.fastq.gz 
  out=raw/SRR10545530_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545660/SRR10545660_1.fastq.gz 
  out=raw/SRR10545660_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545660/SRR10545660_2.fastq.gz 
  out=raw/SRR10545660_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545531/SRR10545531_1.fastq.gz 
  out=raw/SRR10545531_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545531/SRR10545531_2.fastq.gz 
  out=raw/SRR10545531_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545659/SRR10545659_1.fastq.gz 
  out=raw/SRR10545659_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545659/SRR10545659_2.fastq.gz 
  out=raw/SRR10545659_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545532/SRR10545532_1.fastq.gz 
  out=raw/SRR10545532_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545532/SRR10545532_2.fastq.gz 
  out=raw/SRR10545532_GSM4195412_TCR-seq_P5-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545658/SRR10545658_1.fastq.gz 
  out=raw/SRR10545658_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545658/SRR10545658_2.fastq.gz 
  out=raw/SRR10545658_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545533/SRR10545533_1.fastq.gz 
  out=raw/SRR10545533_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545533/SRR10545533_2.fastq.gz 
  out=raw/SRR10545533_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545657/SRR10545657_1.fastq.gz 
  out=raw/SRR10545657_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545657/SRR10545657_2.fastq.gz 
  out=raw/SRR10545657_GSM4195444_TCR-seq_P8-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545656/SRR10545656_1.fastq.gz 
  out=raw/SRR10545656_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545656/SRR10545656_2.fastq.gz 
  out=raw/SRR10545656_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545534/SRR10545534_1.fastq.gz 
  out=raw/SRR10545534_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545534/SRR10545534_2.fastq.gz 
  out=raw/SRR10545534_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545535/SRR10545535_1.fastq.gz 
  out=raw/SRR10545535_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545535/SRR10545535_2.fastq.gz 
  out=raw/SRR10545535_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545655/SRR10545655_1.fastq.gz 
  out=raw/SRR10545655_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545655/SRR10545655_2.fastq.gz 
  out=raw/SRR10545655_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545653/SRR10545653_1.fastq.gz 
  out=raw/SRR10545653_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545653/SRR10545653_2.fastq.gz 
  out=raw/SRR10545653_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545536/SRR10545536_1.fastq.gz 
  out=raw/SRR10545536_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545536/SRR10545536_2.fastq.gz 
  out=raw/SRR10545536_GSM4195413_TCR-seq_P5-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545537/SRR10545537_1.fastq.gz 
  out=raw/SRR10545537_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545537/SRR10545537_2.fastq.gz 
  out=raw/SRR10545537_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545654/SRR10545654_1.fastq.gz 
  out=raw/SRR10545654_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545654/SRR10545654_2.fastq.gz 
  out=raw/SRR10545654_GSM4195443_TCR-seq_P8-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545538/SRR10545538_1.fastq.gz 
  out=raw/SRR10545538_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545538/SRR10545538_2.fastq.gz 
  out=raw/SRR10545538_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545652/SRR10545652_1.fastq.gz 
  out=raw/SRR10545652_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545652/SRR10545652_2.fastq.gz 
  out=raw/SRR10545652_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545539/SRR10545539_1.fastq.gz 
  out=raw/SRR10545539_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545539/SRR10545539_2.fastq.gz 
  out=raw/SRR10545539_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545540/SRR10545540_1.fastq.gz 
  out=raw/SRR10545540_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545540/SRR10545540_2.fastq.gz 
  out=raw/SRR10545540_GSM4195414_TCR-seq_P5-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545651/SRR10545651_1.fastq.gz 
  out=raw/SRR10545651_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545651/SRR10545651_2.fastq.gz 
  out=raw/SRR10545651_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545650/SRR10545650_1.fastq.gz 
  out=raw/SRR10545650_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545650/SRR10545650_2.fastq.gz 
  out=raw/SRR10545650_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545541/SRR10545541_1.fastq.gz 
  out=raw/SRR10545541_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545541/SRR10545541_2.fastq.gz 
  out=raw/SRR10545541_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545649/SRR10545649_1.fastq.gz 
  out=raw/SRR10545649_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545649/SRR10545649_2.fastq.gz 
  out=raw/SRR10545649_GSM4195442_TCR-seq_P8-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545542/SRR10545542_1.fastq.gz 
  out=raw/SRR10545542_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545542/SRR10545542_2.fastq.gz 
  out=raw/SRR10545542_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545648/SRR10545648_1.fastq.gz 
  out=raw/SRR10545648_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545648/SRR10545648_2.fastq.gz 
  out=raw/SRR10545648_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545543/SRR10545543_1.fastq.gz 
  out=raw/SRR10545543_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545543/SRR10545543_2.fastq.gz 
  out=raw/SRR10545543_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545647/SRR10545647_1.fastq.gz 
  out=raw/SRR10545647_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545647/SRR10545647_2.fastq.gz 
  out=raw/SRR10545647_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545646/SRR10545646_1.fastq.gz 
  out=raw/SRR10545646_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545646/SRR10545646_2.fastq.gz 
  out=raw/SRR10545646_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545544/SRR10545544_1.fastq.gz 
  out=raw/SRR10545544_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545544/SRR10545544_2.fastq.gz 
  out=raw/SRR10545544_GSM4195415_TCR-seq_P5-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545545/SRR10545545_1.fastq.gz 
  out=raw/SRR10545545_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545545/SRR10545545_2.fastq.gz 
  out=raw/SRR10545545_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545645/SRR10545645_1.fastq.gz 
  out=raw/SRR10545645_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545645/SRR10545645_2.fastq.gz 
  out=raw/SRR10545645_GSM4195441_TCR-seq_P8-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545546/SRR10545546_1.fastq.gz 
  out=raw/SRR10545546_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545546/SRR10545546_2.fastq.gz 
  out=raw/SRR10545546_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545644/SRR10545644_1.fastq.gz 
  out=raw/SRR10545644_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545644/SRR10545644_2.fastq.gz 
  out=raw/SRR10545644_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545547/SRR10545547_1.fastq.gz 
  out=raw/SRR10545547_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545547/SRR10545547_2.fastq.gz 
  out=raw/SRR10545547_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545643/SRR10545643_1.fastq.gz 
  out=raw/SRR10545643_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545643/SRR10545643_2.fastq.gz 
  out=raw/SRR10545643_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545548/SRR10545548_1.fastq.gz 
  out=raw/SRR10545548_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545548/SRR10545548_2.fastq.gz 
  out=raw/SRR10545548_GSM4195416_TCR-seq_P6-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545642/SRR10545642_1.fastq.gz 
  out=raw/SRR10545642_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545642/SRR10545642_2.fastq.gz 
  out=raw/SRR10545642_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545549/SRR10545549_1.fastq.gz 
  out=raw/SRR10545549_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545549/SRR10545549_2.fastq.gz 
  out=raw/SRR10545549_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545550/SRR10545550_1.fastq.gz 
  out=raw/SRR10545550_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545550/SRR10545550_2.fastq.gz 
  out=raw/SRR10545550_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545641/SRR10545641_1.fastq.gz 
  out=raw/SRR10545641_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545641/SRR10545641_2.fastq.gz 
  out=raw/SRR10545641_GSM4195440_TCR-seq_P8-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545640/SRR10545640_1.fastq.gz 
  out=raw/SRR10545640_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545640/SRR10545640_2.fastq.gz 
  out=raw/SRR10545640_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545639/SRR10545639_1.fastq.gz 
  out=raw/SRR10545639_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545639/SRR10545639_2.fastq.gz 
  out=raw/SRR10545639_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545551/SRR10545551_1.fastq.gz 
  out=raw/SRR10545551_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545551/SRR10545551_2.fastq.gz 
  out=raw/SRR10545551_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545552/SRR10545552_1.fastq.gz 
  out=raw/SRR10545552_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545552/SRR10545552_2.fastq.gz 
  out=raw/SRR10545552_GSM4195417_TCR-seq_P6-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545638/SRR10545638_1.fastq.gz 
  out=raw/SRR10545638_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545638/SRR10545638_2.fastq.gz 
  out=raw/SRR10545638_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545553/SRR10545553_1.fastq.gz 
  out=raw/SRR10545553_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545553/SRR10545553_2.fastq.gz 
  out=raw/SRR10545553_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545637/SRR10545637_1.fastq.gz 
  out=raw/SRR10545637_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545637/SRR10545637_2.fastq.gz 
  out=raw/SRR10545637_GSM4195439_TCR-seq_P8-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545554/SRR10545554_1.fastq.gz 
  out=raw/SRR10545554_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545554/SRR10545554_2.fastq.gz 
  out=raw/SRR10545554_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545555/SRR10545555_1.fastq.gz 
  out=raw/SRR10545555_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545555/SRR10545555_2.fastq.gz 
  out=raw/SRR10545555_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545636/SRR10545636_1.fastq.gz 
  out=raw/SRR10545636_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545636/SRR10545636_2.fastq.gz 
  out=raw/SRR10545636_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545635/SRR10545635_1.fastq.gz 
  out=raw/SRR10545635_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545635/SRR10545635_2.fastq.gz 
  out=raw/SRR10545635_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545556/SRR10545556_1.fastq.gz 
  out=raw/SRR10545556_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545556/SRR10545556_2.fastq.gz 
  out=raw/SRR10545556_GSM4195418_TCR-seq_P6-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545557/SRR10545557_1.fastq.gz 
  out=raw/SRR10545557_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545557/SRR10545557_2.fastq.gz 
  out=raw/SRR10545557_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545634/SRR10545634_1.fastq.gz 
  out=raw/SRR10545634_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545634/SRR10545634_2.fastq.gz 
  out=raw/SRR10545634_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545633/SRR10545633_1.fastq.gz 
  out=raw/SRR10545633_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545633/SRR10545633_2.fastq.gz 
  out=raw/SRR10545633_GSM4195438_TCR-seq_P8-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545558/SRR10545558_1.fastq.gz 
  out=raw/SRR10545558_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545558/SRR10545558_2.fastq.gz 
  out=raw/SRR10545558_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545632/SRR10545632_1.fastq.gz 
  out=raw/SRR10545632_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545632/SRR10545632_2.fastq.gz 
  out=raw/SRR10545632_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545631/SRR10545631_1.fastq.gz 
  out=raw/SRR10545631_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545631/SRR10545631_2.fastq.gz 
  out=raw/SRR10545631_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545560/SRR10545560_1.fastq.gz 
  out=raw/SRR10545560_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545560/SRR10545560_2.fastq.gz 
  out=raw/SRR10545560_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545559/SRR10545559_1.fastq.gz 
  out=raw/SRR10545559_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545559/SRR10545559_2.fastq.gz 
  out=raw/SRR10545559_GSM4195419_TCR-seq_P6-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545630/SRR10545630_1.fastq.gz 
  out=raw/SRR10545630_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545630/SRR10545630_2.fastq.gz 
  out=raw/SRR10545630_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545689/SRR10545689_1.fastq.gz 
  out=raw/SRR10545689_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545689/SRR10545689_2.fastq.gz 
  out=raw/SRR10545689_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545629/SRR10545629_1.fastq.gz 
  out=raw/SRR10545629_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545629/SRR10545629_2.fastq.gz 
  out=raw/SRR10545629_GSM4195437_TCR-seq_P8-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545628/SRR10545628_1.fastq.gz 
  out=raw/SRR10545628_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545628/SRR10545628_2.fastq.gz 
  out=raw/SRR10545628_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545690/SRR10545690_1.fastq.gz 
  out=raw/SRR10545690_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545690/SRR10545690_2.fastq.gz 
  out=raw/SRR10545690_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545691/SRR10545691_1.fastq.gz 
  out=raw/SRR10545691_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545691/SRR10545691_2.fastq.gz 
  out=raw/SRR10545691_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545627/SRR10545627_1.fastq.gz 
  out=raw/SRR10545627_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545627/SRR10545627_2.fastq.gz 
  out=raw/SRR10545627_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545626/SRR10545626_1.fastq.gz 
  out=raw/SRR10545626_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545626/SRR10545626_2.fastq.gz 
  out=raw/SRR10545626_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545692/SRR10545692_1.fastq.gz 
  out=raw/SRR10545692_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545692/SRR10545692_2.fastq.gz 
  out=raw/SRR10545692_GSM4195452_TCR-seq_P14-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545693/SRR10545693_1.fastq.gz 
  out=raw/SRR10545693_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545693/SRR10545693_2.fastq.gz 
  out=raw/SRR10545693_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545625/SRR10545625_1.fastq.gz 
  out=raw/SRR10545625_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545625/SRR10545625_2.fastq.gz 
  out=raw/SRR10545625_GSM4195436_TCR-seq_P8-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545694/SRR10545694_1.fastq.gz 
  out=raw/SRR10545694_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545694/SRR10545694_2.fastq.gz 
  out=raw/SRR10545694_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545624/SRR10545624_1.fastq.gz 
  out=raw/SRR10545624_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545624/SRR10545624_2.fastq.gz 
  out=raw/SRR10545624_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545695/SRR10545695_1.fastq.gz 
  out=raw/SRR10545695_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545695/SRR10545695_2.fastq.gz 
  out=raw/SRR10545695_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545623/SRR10545623_1.fastq.gz 
  out=raw/SRR10545623_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545623/SRR10545623_2.fastq.gz 
  out=raw/SRR10545623_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545696/SRR10545696_1.fastq.gz 
  out=raw/SRR10545696_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545696/SRR10545696_2.fastq.gz 
  out=raw/SRR10545696_GSM4195453_TCR-seq_P14-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545622/SRR10545622_1.fastq.gz 
  out=raw/SRR10545622_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545622/SRR10545622_2.fastq.gz 
  out=raw/SRR10545622_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545697/SRR10545697_1.fastq.gz 
  out=raw/SRR10545697_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545697/SRR10545697_2.fastq.gz 
  out=raw/SRR10545697_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545621/SRR10545621_1.fastq.gz 
  out=raw/SRR10545621_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545621/SRR10545621_2.fastq.gz 
  out=raw/SRR10545621_GSM4195435_TCR-seq_P7-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545698/SRR10545698_1.fastq.gz 
  out=raw/SRR10545698_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545698/SRR10545698_2.fastq.gz 
  out=raw/SRR10545698_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545620/SRR10545620_1.fastq.gz 
  out=raw/SRR10545620_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545620/SRR10545620_2.fastq.gz 
  out=raw/SRR10545620_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545699/SRR10545699_1.fastq.gz 
  out=raw/SRR10545699_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545699/SRR10545699_2.fastq.gz 
  out=raw/SRR10545699_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545700/SRR10545700_1.fastq.gz 
  out=raw/SRR10545700_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545700/SRR10545700_2.fastq.gz 
  out=raw/SRR10545700_GSM4195454_TCR-seq_P14-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545619/SRR10545619_1.fastq.gz 
  out=raw/SRR10545619_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545619/SRR10545619_2.fastq.gz 
  out=raw/SRR10545619_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545701/SRR10545701_1.fastq.gz 
  out=raw/SRR10545701_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545701/SRR10545701_2.fastq.gz 
  out=raw/SRR10545701_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545618/SRR10545618_1.fastq.gz 
  out=raw/SRR10545618_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545618/SRR10545618_2.fastq.gz 
  out=raw/SRR10545618_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545617/SRR10545617_1.fastq.gz 
  out=raw/SRR10545617_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545617/SRR10545617_2.fastq.gz 
  out=raw/SRR10545617_GSM4195434_TCR-seq_P7-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545702/SRR10545702_1.fastq.gz 
  out=raw/SRR10545702_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545702/SRR10545702_2.fastq.gz 
  out=raw/SRR10545702_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545616/SRR10545616_1.fastq.gz 
  out=raw/SRR10545616_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545616/SRR10545616_2.fastq.gz 
  out=raw/SRR10545616_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545703/SRR10545703_1.fastq.gz 
  out=raw/SRR10545703_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545703/SRR10545703_2.fastq.gz 
  out=raw/SRR10545703_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545615/SRR10545615_1.fastq.gz 
  out=raw/SRR10545615_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545615/SRR10545615_2.fastq.gz 
  out=raw/SRR10545615_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545704/SRR10545704_1.fastq.gz 
  out=raw/SRR10545704_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545704/SRR10545704_2.fastq.gz 
  out=raw/SRR10545704_GSM4195455_TCR-seq_P14-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545614/SRR10545614_1.fastq.gz 
  out=raw/SRR10545614_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545614/SRR10545614_2.fastq.gz 
  out=raw/SRR10545614_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545705/SRR10545705_1.fastq.gz 
  out=raw/SRR10545705_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545705/SRR10545705_2.fastq.gz 
  out=raw/SRR10545705_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545613/SRR10545613_1.fastq.gz 
  out=raw/SRR10545613_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545613/SRR10545613_2.fastq.gz 
  out=raw/SRR10545613_GSM4195433_TCR-seq_P7-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545706/SRR10545706_1.fastq.gz 
  out=raw/SRR10545706_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545706/SRR10545706_2.fastq.gz 
  out=raw/SRR10545706_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545612/SRR10545612_1.fastq.gz 
  out=raw/SRR10545612_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545612/SRR10545612_2.fastq.gz 
  out=raw/SRR10545612_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545707/SRR10545707_1.fastq.gz 
  out=raw/SRR10545707_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545707/SRR10545707_2.fastq.gz 
  out=raw/SRR10545707_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545611/SRR10545611_1.fastq.gz 
  out=raw/SRR10545611_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545611/SRR10545611_2.fastq.gz 
  out=raw/SRR10545611_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545708/SRR10545708_1.fastq.gz 
  out=raw/SRR10545708_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545708/SRR10545708_2.fastq.gz 
  out=raw/SRR10545708_GSM4195456_TCR-seq_P14-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545610/SRR10545610_1.fastq.gz 
  out=raw/SRR10545610_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545610/SRR10545610_2.fastq.gz 
  out=raw/SRR10545610_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545709/SRR10545709_1.fastq.gz 
  out=raw/SRR10545709_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545709/SRR10545709_2.fastq.gz 
  out=raw/SRR10545709_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545609/SRR10545609_1.fastq.gz 
  out=raw/SRR10545609_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545609/SRR10545609_2.fastq.gz 
  out=raw/SRR10545609_GSM4195432_TCR-seq_P7-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545608/SRR10545608_1.fastq.gz 
  out=raw/SRR10545608_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545608/SRR10545608_2.fastq.gz 
  out=raw/SRR10545608_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545710/SRR10545710_1.fastq.gz 
  out=raw/SRR10545710_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545710/SRR10545710_2.fastq.gz 
  out=raw/SRR10545710_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545711/SRR10545711_1.fastq.gz 
  out=raw/SRR10545711_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545711/SRR10545711_2.fastq.gz 
  out=raw/SRR10545711_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545607/SRR10545607_1.fastq.gz 
  out=raw/SRR10545607_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545607/SRR10545607_2.fastq.gz 
  out=raw/SRR10545607_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545712/SRR10545712_1.fastq.gz 
  out=raw/SRR10545712_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545712/SRR10545712_2.fastq.gz 
  out=raw/SRR10545712_GSM4195457_TCR-seq_P14-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545606/SRR10545606_1.fastq.gz 
  out=raw/SRR10545606_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545606/SRR10545606_2.fastq.gz 
  out=raw/SRR10545606_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545605/SRR10545605_1.fastq.gz 
  out=raw/SRR10545605_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545605/SRR10545605_2.fastq.gz 
  out=raw/SRR10545605_GSM4195431_TCR-seq_P7-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545713/SRR10545713_1.fastq.gz 
  out=raw/SRR10545713_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545713/SRR10545713_2.fastq.gz 
  out=raw/SRR10545713_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545714/SRR10545714_1.fastq.gz 
  out=raw/SRR10545714_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545714/SRR10545714_2.fastq.gz 
  out=raw/SRR10545714_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545715/SRR10545715_1.fastq.gz 
  out=raw/SRR10545715_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545715/SRR10545715_2.fastq.gz 
  out=raw/SRR10545715_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545603/SRR10545603_1.fastq.gz 
  out=raw/SRR10545603_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545603/SRR10545603_2.fastq.gz 
  out=raw/SRR10545603_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545604/SRR10545604_1.fastq.gz 
  out=raw/SRR10545604_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545604/SRR10545604_2.fastq.gz 
  out=raw/SRR10545604_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545716/SRR10545716_1.fastq.gz 
  out=raw/SRR10545716_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545716/SRR10545716_2.fastq.gz 
  out=raw/SRR10545716_GSM4195458_TCR-seq_P14-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545602/SRR10545602_1.fastq.gz 
  out=raw/SRR10545602_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545602/SRR10545602_2.fastq.gz 
  out=raw/SRR10545602_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545717/SRR10545717_1.fastq.gz 
  out=raw/SRR10545717_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545717/SRR10545717_2.fastq.gz 
  out=raw/SRR10545717_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545601/SRR10545601_1.fastq.gz 
  out=raw/SRR10545601_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545601/SRR10545601_2.fastq.gz 
  out=raw/SRR10545601_GSM4195430_TCR-seq_P7-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545718/SRR10545718_1.fastq.gz 
  out=raw/SRR10545718_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545718/SRR10545718_2.fastq.gz 
  out=raw/SRR10545718_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545600/SRR10545600_1.fastq.gz 
  out=raw/SRR10545600_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545600/SRR10545600_2.fastq.gz 
  out=raw/SRR10545600_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545719/SRR10545719_1.fastq.gz 
  out=raw/SRR10545719_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545719/SRR10545719_2.fastq.gz 
  out=raw/SRR10545719_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545599/SRR10545599_1.fastq.gz 
  out=raw/SRR10545599_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545599/SRR10545599_2.fastq.gz 
  out=raw/SRR10545599_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545720/SRR10545720_1.fastq.gz 
  out=raw/SRR10545720_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545720/SRR10545720_2.fastq.gz 
  out=raw/SRR10545720_GSM4195459_TCR-seq_P14-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545598/SRR10545598_1.fastq.gz 
  out=raw/SRR10545598_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545598/SRR10545598_2.fastq.gz 
  out=raw/SRR10545598_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545721/SRR10545721_1.fastq.gz 
  out=raw/SRR10545721_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545721/SRR10545721_2.fastq.gz 
  out=raw/SRR10545721_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545597/SRR10545597_1.fastq.gz 
  out=raw/SRR10545597_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545597/SRR10545597_2.fastq.gz 
  out=raw/SRR10545597_GSM4195429_TCR-seq_P7-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545722/SRR10545722_1.fastq.gz 
  out=raw/SRR10545722_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545722/SRR10545722_2.fastq.gz 
  out=raw/SRR10545722_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545596/SRR10545596_1.fastq.gz 
  out=raw/SRR10545596_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545596/SRR10545596_2.fastq.gz 
  out=raw/SRR10545596_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545723/SRR10545723_1.fastq.gz 
  out=raw/SRR10545723_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545723/SRR10545723_2.fastq.gz 
  out=raw/SRR10545723_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545595/SRR10545595_1.fastq.gz 
  out=raw/SRR10545595_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545595/SRR10545595_2.fastq.gz 
  out=raw/SRR10545595_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545594/SRR10545594_1.fastq.gz 
  out=raw/SRR10545594_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545594/SRR10545594_2.fastq.gz 
  out=raw/SRR10545594_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545724/SRR10545724_1.fastq.gz 
  out=raw/SRR10545724_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545724/SRR10545724_2.fastq.gz 
  out=raw/SRR10545724_GSM4195460_TCR-seq_P15-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545725/SRR10545725_1.fastq.gz 
  out=raw/SRR10545725_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545725/SRR10545725_2.fastq.gz 
  out=raw/SRR10545725_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545593/SRR10545593_1.fastq.gz 
  out=raw/SRR10545593_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545593/SRR10545593_2.fastq.gz 
  out=raw/SRR10545593_GSM4195428_TCR-seq_P7-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545726/SRR10545726_1.fastq.gz 
  out=raw/SRR10545726_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545726/SRR10545726_2.fastq.gz 
  out=raw/SRR10545726_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545727/SRR10545727_1.fastq.gz 
  out=raw/SRR10545727_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545727/SRR10545727_2.fastq.gz 
  out=raw/SRR10545727_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545592/SRR10545592_1.fastq.gz 
  out=raw/SRR10545592_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545592/SRR10545592_2.fastq.gz 
  out=raw/SRR10545592_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545591/SRR10545591_1.fastq.gz 
  out=raw/SRR10545591_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545591/SRR10545591_2.fastq.gz 
  out=raw/SRR10545591_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545590/SRR10545590_1.fastq.gz 
  out=raw/SRR10545590_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545590/SRR10545590_2.fastq.gz 
  out=raw/SRR10545590_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545728/SRR10545728_1.fastq.gz 
  out=raw/SRR10545728_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545728/SRR10545728_2.fastq.gz 
  out=raw/SRR10545728_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545729/SRR10545729_1.fastq.gz 
  out=raw/SRR10545729_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545729/SRR10545729_2.fastq.gz 
  out=raw/SRR10545729_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545589/SRR10545589_1.fastq.gz 
  out=raw/SRR10545589_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545589/SRR10545589_2.fastq.gz 
  out=raw/SRR10545589_GSM4195427_TCR-seq_P7-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545730/SRR10545730_1.fastq.gz 
  out=raw/SRR10545730_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545730/SRR10545730_2.fastq.gz 
  out=raw/SRR10545730_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545588/SRR10545588_1.fastq.gz 
  out=raw/SRR10545588_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545588/SRR10545588_2.fastq.gz 
  out=raw/SRR10545588_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545732/SRR10545732_1.fastq.gz 
  out=raw/SRR10545732_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545732/SRR10545732_2.fastq.gz 
  out=raw/SRR10545732_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545731/SRR10545731_1.fastq.gz 
  out=raw/SRR10545731_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545731/SRR10545731_2.fastq.gz 
  out=raw/SRR10545731_GSM4195462_TCR-seq_P15-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545587/SRR10545587_1.fastq.gz 
  out=raw/SRR10545587_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545587/SRR10545587_2.fastq.gz 
  out=raw/SRR10545587_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545733/SRR10545733_1.fastq.gz 
  out=raw/SRR10545733_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545733/SRR10545733_2.fastq.gz 
  out=raw/SRR10545733_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545586/SRR10545586_1.fastq.gz 
  out=raw/SRR10545586_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545586/SRR10545586_2.fastq.gz 
  out=raw/SRR10545586_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545585/SRR10545585_1.fastq.gz 
  out=raw/SRR10545585_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545585/SRR10545585_2.fastq.gz 
  out=raw/SRR10545585_GSM4195426_TCR-seq_P7-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545734/SRR10545734_1.fastq.gz 
  out=raw/SRR10545734_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545734/SRR10545734_2.fastq.gz 
  out=raw/SRR10545734_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545584/SRR10545584_1.fastq.gz 
  out=raw/SRR10545584_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545584/SRR10545584_2.fastq.gz 
  out=raw/SRR10545584_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545735/SRR10545735_1.fastq.gz 
  out=raw/SRR10545735_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545735/SRR10545735_2.fastq.gz 
  out=raw/SRR10545735_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545583/SRR10545583_1.fastq.gz 
  out=raw/SRR10545583_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545583/SRR10545583_2.fastq.gz 
  out=raw/SRR10545583_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545582/SRR10545582_1.fastq.gz 
  out=raw/SRR10545582_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545582/SRR10545582_2.fastq.gz 
  out=raw/SRR10545582_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545581/SRR10545581_1.fastq.gz 
  out=raw/SRR10545581_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545581/SRR10545581_2.fastq.gz 
  out=raw/SRR10545581_GSM4195425_TCR-seq_P7-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545737/SRR10545737_1.fastq.gz 
  out=raw/SRR10545737_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545737/SRR10545737_2.fastq.gz 
  out=raw/SRR10545737_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545736/SRR10545736_1.fastq.gz 
  out=raw/SRR10545736_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545736/SRR10545736_2.fastq.gz 
  out=raw/SRR10545736_GSM4195463_TCR-seq_P15-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545738/SRR10545738_1.fastq.gz 
  out=raw/SRR10545738_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545738/SRR10545738_2.fastq.gz 
  out=raw/SRR10545738_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545580/SRR10545580_1.fastq.gz 
  out=raw/SRR10545580_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545580/SRR10545580_2.fastq.gz 
  out=raw/SRR10545580_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545739/SRR10545739_1.fastq.gz 
  out=raw/SRR10545739_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545739/SRR10545739_2.fastq.gz 
  out=raw/SRR10545739_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545579/SRR10545579_1.fastq.gz 
  out=raw/SRR10545579_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545579/SRR10545579_2.fastq.gz 
  out=raw/SRR10545579_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545740/SRR10545740_1.fastq.gz 
  out=raw/SRR10545740_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545740/SRR10545740_2.fastq.gz 
  out=raw/SRR10545740_GSM4195464_TCR-seq_P15-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545578/SRR10545578_1.fastq.gz 
  out=raw/SRR10545578_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545578/SRR10545578_2.fastq.gz 
  out=raw/SRR10545578_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545577/SRR10545577_1.fastq.gz 
  out=raw/SRR10545577_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545577/SRR10545577_2.fastq.gz 
  out=raw/SRR10545577_GSM4195424_TCR-seq_P7-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545741/SRR10545741_1.fastq.gz 
  out=raw/SRR10545741_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545741/SRR10545741_2.fastq.gz 
  out=raw/SRR10545741_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545742/SRR10545742_1.fastq.gz 
  out=raw/SRR10545742_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545742/SRR10545742_2.fastq.gz 
  out=raw/SRR10545742_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545576/SRR10545576_1.fastq.gz 
  out=raw/SRR10545576_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545576/SRR10545576_2.fastq.gz 
  out=raw/SRR10545576_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545743/SRR10545743_1.fastq.gz 
  out=raw/SRR10545743_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545743/SRR10545743_2.fastq.gz 
  out=raw/SRR10545743_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545575/SRR10545575_1.fastq.gz 
  out=raw/SRR10545575_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545575/SRR10545575_2.fastq.gz 
  out=raw/SRR10545575_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545744/SRR10545744_1.fastq.gz 
  out=raw/SRR10545744_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545744/SRR10545744_2.fastq.gz 
  out=raw/SRR10545744_GSM4195465_TCR-seq_P15-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545573/SRR10545573_1.fastq.gz 
  out=raw/SRR10545573_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545573/SRR10545573_2.fastq.gz 
  out=raw/SRR10545573_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545745/SRR10545745_1.fastq.gz 
  out=raw/SRR10545745_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545745/SRR10545745_2.fastq.gz 
  out=raw/SRR10545745_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545574/SRR10545574_1.fastq.gz 
  out=raw/SRR10545574_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545574/SRR10545574_2.fastq.gz 
  out=raw/SRR10545574_GSM4195423_TCR-seq_P6-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545572/SRR10545572_1.fastq.gz 
  out=raw/SRR10545572_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545572/SRR10545572_2.fastq.gz 
  out=raw/SRR10545572_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545746/SRR10545746_1.fastq.gz 
  out=raw/SRR10545746_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545746/SRR10545746_2.fastq.gz 
  out=raw/SRR10545746_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545747/SRR10545747_1.fastq.gz 
  out=raw/SRR10545747_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545747/SRR10545747_2.fastq.gz 
  out=raw/SRR10545747_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545571/SRR10545571_1.fastq.gz 
  out=raw/SRR10545571_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545571/SRR10545571_2.fastq.gz 
  out=raw/SRR10545571_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545748/SRR10545748_1.fastq.gz 
  out=raw/SRR10545748_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545748/SRR10545748_2.fastq.gz 
  out=raw/SRR10545748_GSM4195466_TCR-seq_P15-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545570/SRR10545570_1.fastq.gz 
  out=raw/SRR10545570_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545570/SRR10545570_2.fastq.gz 
  out=raw/SRR10545570_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545749/SRR10545749_1.fastq.gz 
  out=raw/SRR10545749_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545749/SRR10545749_2.fastq.gz 
  out=raw/SRR10545749_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545569/SRR10545569_1.fastq.gz 
  out=raw/SRR10545569_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545569/SRR10545569_2.fastq.gz 
  out=raw/SRR10545569_GSM4195422_TCR-seq_P6-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545751/SRR10545751_1.fastq.gz 
  out=raw/SRR10545751_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545751/SRR10545751_2.fastq.gz 
  out=raw/SRR10545751_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545568/SRR10545568_1.fastq.gz 
  out=raw/SRR10545568_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545568/SRR10545568_2.fastq.gz 
  out=raw/SRR10545568_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545750/SRR10545750_1.fastq.gz 
  out=raw/SRR10545750_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545750/SRR10545750_2.fastq.gz 
  out=raw/SRR10545750_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545567/SRR10545567_1.fastq.gz 
  out=raw/SRR10545567_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545567/SRR10545567_2.fastq.gz 
  out=raw/SRR10545567_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545752/SRR10545752_1.fastq.gz 
  out=raw/SRR10545752_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545752/SRR10545752_2.fastq.gz 
  out=raw/SRR10545752_GSM4195467_TCR-seq_P15-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545566/SRR10545566_1.fastq.gz 
  out=raw/SRR10545566_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545566/SRR10545566_2.fastq.gz 
  out=raw/SRR10545566_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545753/SRR10545753_1.fastq.gz 
  out=raw/SRR10545753_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545753/SRR10545753_2.fastq.gz 
  out=raw/SRR10545753_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545754/SRR10545754_1.fastq.gz 
  out=raw/SRR10545754_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545754/SRR10545754_2.fastq.gz 
  out=raw/SRR10545754_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545563/SRR10545563_1.fastq.gz 
  out=raw/SRR10545563_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545563/SRR10545563_2.fastq.gz 
  out=raw/SRR10545563_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545565/SRR10545565_1.fastq.gz 
  out=raw/SRR10545565_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545565/SRR10545565_2.fastq.gz 
  out=raw/SRR10545565_GSM4195421_TCR-seq_P6-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545564/SRR10545564_1.fastq.gz 
  out=raw/SRR10545564_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545564/SRR10545564_2.fastq.gz 
  out=raw/SRR10545564_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545755/SRR10545755_1.fastq.gz 
  out=raw/SRR10545755_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545755/SRR10545755_2.fastq.gz 
  out=raw/SRR10545755_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545756/SRR10545756_1.fastq.gz 
  out=raw/SRR10545756_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545756/SRR10545756_2.fastq.gz 
  out=raw/SRR10545756_GSM4195468_TCR-seq_P15-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545562/SRR10545562_1.fastq.gz 
  out=raw/SRR10545562_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545562/SRR10545562_2.fastq.gz 
  out=raw/SRR10545562_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545757/SRR10545757_1.fastq.gz 
  out=raw/SRR10545757_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545757/SRR10545757_2.fastq.gz 
  out=raw/SRR10545757_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545561/SRR10545561_1.fastq.gz 
  out=raw/SRR10545561_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545561/SRR10545561_2.fastq.gz 
  out=raw/SRR10545561_GSM4195420_TCR-seq_P6-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10546039/SRR10546039_1.fastq.gz 
  out=raw/SRR10546039_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10546039/SRR10546039_2.fastq.gz 
  out=raw/SRR10546039_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545758/SRR10545758_1.fastq.gz 
  out=raw/SRR10545758_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545758/SRR10545758_2.fastq.gz 
  out=raw/SRR10545758_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10546040/SRR10546040_1.fastq.gz 
  out=raw/SRR10546040_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10546040/SRR10546040_2.fastq.gz 
  out=raw/SRR10546040_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545759/SRR10545759_1.fastq.gz 
  out=raw/SRR10545759_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545759/SRR10545759_2.fastq.gz 
  out=raw/SRR10545759_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545760/SRR10545760_1.fastq.gz 
  out=raw/SRR10545760_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545760/SRR10545760_2.fastq.gz 
  out=raw/SRR10545760_GSM4195469_TCR-seq_P15-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10546038/SRR10546038_1.fastq.gz 
  out=raw/SRR10546038_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10546038/SRR10546038_2.fastq.gz 
  out=raw/SRR10546038_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545761/SRR10545761_1.fastq.gz 
  out=raw/SRR10545761_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545761/SRR10545761_2.fastq.gz 
  out=raw/SRR10545761_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10546037/SRR10546037_1.fastq.gz 
  out=raw/SRR10546037_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10546037/SRR10546037_2.fastq.gz 
  out=raw/SRR10546037_GSM4195539_TCR-seq_P23-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545762/SRR10545762_1.fastq.gz 
  out=raw/SRR10545762_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545762/SRR10545762_2.fastq.gz 
  out=raw/SRR10545762_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10546036/SRR10546036_1.fastq.gz 
  out=raw/SRR10546036_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10546036/SRR10546036_2.fastq.gz 
  out=raw/SRR10546036_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545763/SRR10545763_1.fastq.gz 
  out=raw/SRR10545763_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545763/SRR10545763_2.fastq.gz 
  out=raw/SRR10545763_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10546034/SRR10546034_1.fastq.gz 
  out=raw/SRR10546034_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10546034/SRR10546034_2.fastq.gz 
  out=raw/SRR10546034_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545764/SRR10545764_1.fastq.gz 
  out=raw/SRR10545764_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545764/SRR10545764_2.fastq.gz 
  out=raw/SRR10545764_GSM4195470_TCR-seq_P15-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10546035/SRR10546035_1.fastq.gz 
  out=raw/SRR10546035_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10546035/SRR10546035_2.fastq.gz 
  out=raw/SRR10546035_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545765/SRR10545765_1.fastq.gz 
  out=raw/SRR10545765_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545765/SRR10545765_2.fastq.gz 
  out=raw/SRR10545765_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10546033/SRR10546033_1.fastq.gz 
  out=raw/SRR10546033_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10546033/SRR10546033_2.fastq.gz 
  out=raw/SRR10546033_GSM4195538_TCR-seq_P23-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545766/SRR10545766_1.fastq.gz 
  out=raw/SRR10545766_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545766/SRR10545766_2.fastq.gz 
  out=raw/SRR10545766_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10546032/SRR10546032_1.fastq.gz 
  out=raw/SRR10546032_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10546032/SRR10546032_2.fastq.gz 
  out=raw/SRR10546032_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545767/SRR10545767_1.fastq.gz 
  out=raw/SRR10545767_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545767/SRR10545767_2.fastq.gz 
  out=raw/SRR10545767_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10546031/SRR10546031_1.fastq.gz 
  out=raw/SRR10546031_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10546031/SRR10546031_2.fastq.gz 
  out=raw/SRR10546031_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545768/SRR10545768_1.fastq.gz 
  out=raw/SRR10545768_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545768/SRR10545768_2.fastq.gz 
  out=raw/SRR10545768_GSM4195471_TCR-seq_P15-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545769/SRR10545769_1.fastq.gz 
  out=raw/SRR10545769_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545769/SRR10545769_2.fastq.gz 
  out=raw/SRR10545769_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10546030/SRR10546030_1.fastq.gz 
  out=raw/SRR10546030_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10546030/SRR10546030_2.fastq.gz 
  out=raw/SRR10546030_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10546029/SRR10546029_1.fastq.gz 
  out=raw/SRR10546029_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10546029/SRR10546029_2.fastq.gz 
  out=raw/SRR10546029_GSM4195537_TCR-seq_P23-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545770/SRR10545770_1.fastq.gz 
  out=raw/SRR10545770_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545770/SRR10545770_2.fastq.gz 
  out=raw/SRR10545770_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10546028/SRR10546028_1.fastq.gz 
  out=raw/SRR10546028_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10546028/SRR10546028_2.fastq.gz 
  out=raw/SRR10546028_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545771/SRR10545771_1.fastq.gz 
  out=raw/SRR10545771_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545771/SRR10545771_2.fastq.gz 
  out=raw/SRR10545771_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545772/SRR10545772_1.fastq.gz 
  out=raw/SRR10545772_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545772/SRR10545772_2.fastq.gz 
  out=raw/SRR10545772_GSM4195472_TCR-seq_P16-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10546027/SRR10546027_1.fastq.gz 
  out=raw/SRR10546027_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10546027/SRR10546027_2.fastq.gz 
  out=raw/SRR10546027_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10546026/SRR10546026_1.fastq.gz 
  out=raw/SRR10546026_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10546026/SRR10546026_2.fastq.gz 
  out=raw/SRR10546026_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545773/SRR10545773_1.fastq.gz 
  out=raw/SRR10545773_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545773/SRR10545773_2.fastq.gz 
  out=raw/SRR10545773_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10546025/SRR10546025_1.fastq.gz 
  out=raw/SRR10546025_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10546025/SRR10546025_2.fastq.gz 
  out=raw/SRR10546025_GSM4195536_TCR-seq_P23-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545774/SRR10545774_1.fastq.gz 
  out=raw/SRR10545774_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545774/SRR10545774_2.fastq.gz 
  out=raw/SRR10545774_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10546024/SRR10546024_1.fastq.gz 
  out=raw/SRR10546024_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10546024/SRR10546024_2.fastq.gz 
  out=raw/SRR10546024_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545775/SRR10545775_1.fastq.gz 
  out=raw/SRR10545775_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545775/SRR10545775_2.fastq.gz 
  out=raw/SRR10545775_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10546023/SRR10546023_1.fastq.gz 
  out=raw/SRR10546023_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10546023/SRR10546023_2.fastq.gz 
  out=raw/SRR10546023_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10546022/SRR10546022_1.fastq.gz 
  out=raw/SRR10546022_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10546022/SRR10546022_2.fastq.gz 
  out=raw/SRR10546022_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545776/SRR10545776_1.fastq.gz 
  out=raw/SRR10545776_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545776/SRR10545776_2.fastq.gz 
  out=raw/SRR10545776_GSM4195473_TCR-seq_P16-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545777/SRR10545777_1.fastq.gz 
  out=raw/SRR10545777_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545777/SRR10545777_2.fastq.gz 
  out=raw/SRR10545777_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10546021/SRR10546021_1.fastq.gz 
  out=raw/SRR10546021_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10546021/SRR10546021_2.fastq.gz 
  out=raw/SRR10546021_GSM4195535_TCR-seq_P23-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545778/SRR10545778_1.fastq.gz 
  out=raw/SRR10545778_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545778/SRR10545778_2.fastq.gz 
  out=raw/SRR10545778_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10546020/SRR10546020_1.fastq.gz 
  out=raw/SRR10546020_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10546020/SRR10546020_2.fastq.gz 
  out=raw/SRR10546020_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545779/SRR10545779_1.fastq.gz 
  out=raw/SRR10545779_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545779/SRR10545779_2.fastq.gz 
  out=raw/SRR10545779_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10546019/SRR10546019_1.fastq.gz 
  out=raw/SRR10546019_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10546019/SRR10546019_2.fastq.gz 
  out=raw/SRR10546019_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545780/SRR10545780_1.fastq.gz 
  out=raw/SRR10545780_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545780/SRR10545780_2.fastq.gz 
  out=raw/SRR10545780_GSM4195474_TCR-seq_P16-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545781/SRR10545781_1.fastq.gz 
  out=raw/SRR10545781_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545781/SRR10545781_2.fastq.gz 
  out=raw/SRR10545781_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10546018/SRR10546018_1.fastq.gz 
  out=raw/SRR10546018_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10546018/SRR10546018_2.fastq.gz 
  out=raw/SRR10546018_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545782/SRR10545782_1.fastq.gz 
  out=raw/SRR10545782_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545782/SRR10545782_2.fastq.gz 
  out=raw/SRR10545782_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10546017/SRR10546017_1.fastq.gz 
  out=raw/SRR10546017_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10546017/SRR10546017_2.fastq.gz 
  out=raw/SRR10546017_GSM4195534_TCR-seq_P23-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545783/SRR10545783_1.fastq.gz 
  out=raw/SRR10545783_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545783/SRR10545783_2.fastq.gz 
  out=raw/SRR10545783_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10546016/SRR10546016_1.fastq.gz 
  out=raw/SRR10546016_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10546016/SRR10546016_2.fastq.gz 
  out=raw/SRR10546016_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10546015/SRR10546015_1.fastq.gz 
  out=raw/SRR10546015_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10546015/SRR10546015_2.fastq.gz 
  out=raw/SRR10546015_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545784/SRR10545784_1.fastq.gz 
  out=raw/SRR10545784_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545784/SRR10545784_2.fastq.gz 
  out=raw/SRR10545784_GSM4195475_TCR-seq_P16-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10546014/SRR10546014_1.fastq.gz 
  out=raw/SRR10546014_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10546014/SRR10546014_2.fastq.gz 
  out=raw/SRR10546014_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10546013/SRR10546013_1.fastq.gz 
  out=raw/SRR10546013_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10546013/SRR10546013_2.fastq.gz 
  out=raw/SRR10546013_GSM4195533_TCR-seq_P23-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545785/SRR10545785_1.fastq.gz 
  out=raw/SRR10545785_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545785/SRR10545785_2.fastq.gz 
  out=raw/SRR10545785_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10546012/SRR10546012_1.fastq.gz 
  out=raw/SRR10546012_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10546012/SRR10546012_2.fastq.gz 
  out=raw/SRR10546012_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545786/SRR10545786_1.fastq.gz 
  out=raw/SRR10545786_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545786/SRR10545786_2.fastq.gz 
  out=raw/SRR10545786_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10546011/SRR10546011_1.fastq.gz 
  out=raw/SRR10546011_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10546011/SRR10546011_2.fastq.gz 
  out=raw/SRR10546011_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545787/SRR10545787_1.fastq.gz 
  out=raw/SRR10545787_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545787/SRR10545787_2.fastq.gz 
  out=raw/SRR10545787_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545788/SRR10545788_1.fastq.gz 
  out=raw/SRR10545788_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545788/SRR10545788_2.fastq.gz 
  out=raw/SRR10545788_GSM4195476_TCR-seq_P16-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10546010/SRR10546010_1.fastq.gz 
  out=raw/SRR10546010_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10546010/SRR10546010_2.fastq.gz 
  out=raw/SRR10546010_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545789/SRR10545789_1.fastq.gz 
  out=raw/SRR10545789_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545789/SRR10545789_2.fastq.gz 
  out=raw/SRR10545789_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10546009/SRR10546009_1.fastq.gz 
  out=raw/SRR10546009_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10546009/SRR10546009_2.fastq.gz 
  out=raw/SRR10546009_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545790/SRR10545790_1.fastq.gz 
  out=raw/SRR10545790_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545790/SRR10545790_2.fastq.gz 
  out=raw/SRR10545790_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10546008/SRR10546008_1.fastq.gz 
  out=raw/SRR10546008_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10546008/SRR10546008_2.fastq.gz 
  out=raw/SRR10546008_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545791/SRR10545791_1.fastq.gz 
  out=raw/SRR10545791_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545791/SRR10545791_2.fastq.gz 
  out=raw/SRR10545791_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10546007/SRR10546007_1.fastq.gz 
  out=raw/SRR10546007_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10546007/SRR10546007_2.fastq.gz 
  out=raw/SRR10546007_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545792/SRR10545792_1.fastq.gz 
  out=raw/SRR10545792_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545792/SRR10545792_2.fastq.gz 
  out=raw/SRR10545792_GSM4195477_TCR-seq_P16-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10546006/SRR10546006_1.fastq.gz 
  out=raw/SRR10546006_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10546006/SRR10546006_2.fastq.gz 
  out=raw/SRR10546006_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545793/SRR10545793_1.fastq.gz 
  out=raw/SRR10545793_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545793/SRR10545793_2.fastq.gz 
  out=raw/SRR10545793_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10546005/SRR10546005_1.fastq.gz 
  out=raw/SRR10546005_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10546005/SRR10546005_2.fastq.gz 
  out=raw/SRR10546005_GSM4195531_TCR-seq_P22-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10546004/SRR10546004_1.fastq.gz 
  out=raw/SRR10546004_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10546004/SRR10546004_2.fastq.gz 
  out=raw/SRR10546004_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545794/SRR10545794_1.fastq.gz 
  out=raw/SRR10545794_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545794/SRR10545794_2.fastq.gz 
  out=raw/SRR10545794_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545795/SRR10545795_1.fastq.gz 
  out=raw/SRR10545795_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545795/SRR10545795_2.fastq.gz 
  out=raw/SRR10545795_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10546003/SRR10546003_1.fastq.gz 
  out=raw/SRR10546003_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10546003/SRR10546003_2.fastq.gz 
  out=raw/SRR10546003_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545796/SRR10545796_1.fastq.gz 
  out=raw/SRR10545796_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545796/SRR10545796_2.fastq.gz 
  out=raw/SRR10545796_GSM4195478_TCR-seq_P16-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10546002/SRR10546002_1.fastq.gz 
  out=raw/SRR10546002_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10546002/SRR10546002_2.fastq.gz 
  out=raw/SRR10546002_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545797/SRR10545797_1.fastq.gz 
  out=raw/SRR10545797_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545797/SRR10545797_2.fastq.gz 
  out=raw/SRR10545797_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10546001/SRR10546001_1.fastq.gz 
  out=raw/SRR10546001_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10546001/SRR10546001_2.fastq.gz 
  out=raw/SRR10546001_GSM4195530_TCR-seq_P22-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545798/SRR10545798_1.fastq.gz 
  out=raw/SRR10545798_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545798/SRR10545798_2.fastq.gz 
  out=raw/SRR10545798_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545799/SRR10545799_1.fastq.gz 
  out=raw/SRR10545799_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545799/SRR10545799_2.fastq.gz 
  out=raw/SRR10545799_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545999/SRR10545999_1.fastq.gz 
  out=raw/SRR10545999_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545999/SRR10545999_2.fastq.gz 
  out=raw/SRR10545999_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10546000/SRR10546000_1.fastq.gz 
  out=raw/SRR10546000_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10546000/SRR10546000_2.fastq.gz 
  out=raw/SRR10546000_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545800/SRR10545800_1.fastq.gz 
  out=raw/SRR10545800_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545800/SRR10545800_2.fastq.gz 
  out=raw/SRR10545800_GSM4195479_TCR-seq_P16-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545998/SRR10545998_1.fastq.gz 
  out=raw/SRR10545998_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545998/SRR10545998_2.fastq.gz 
  out=raw/SRR10545998_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545801/SRR10545801_1.fastq.gz 
  out=raw/SRR10545801_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545801/SRR10545801_2.fastq.gz 
  out=raw/SRR10545801_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545997/SRR10545997_1.fastq.gz 
  out=raw/SRR10545997_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545997/SRR10545997_2.fastq.gz 
  out=raw/SRR10545997_GSM4195529_TCR-seq_P22-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545802/SRR10545802_1.fastq.gz 
  out=raw/SRR10545802_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545802/SRR10545802_2.fastq.gz 
  out=raw/SRR10545802_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545996/SRR10545996_1.fastq.gz 
  out=raw/SRR10545996_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545996/SRR10545996_2.fastq.gz 
  out=raw/SRR10545996_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545803/SRR10545803_1.fastq.gz 
  out=raw/SRR10545803_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545803/SRR10545803_2.fastq.gz 
  out=raw/SRR10545803_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545804/SRR10545804_1.fastq.gz 
  out=raw/SRR10545804_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545804/SRR10545804_2.fastq.gz 
  out=raw/SRR10545804_GSM4195480_TCR-seq_P16-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545995/SRR10545995_1.fastq.gz 
  out=raw/SRR10545995_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545995/SRR10545995_2.fastq.gz 
  out=raw/SRR10545995_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545994/SRR10545994_1.fastq.gz 
  out=raw/SRR10545994_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545994/SRR10545994_2.fastq.gz 
  out=raw/SRR10545994_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545805/SRR10545805_1.fastq.gz 
  out=raw/SRR10545805_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545805/SRR10545805_2.fastq.gz 
  out=raw/SRR10545805_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545993/SRR10545993_1.fastq.gz 
  out=raw/SRR10545993_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545993/SRR10545993_2.fastq.gz 
  out=raw/SRR10545993_GSM4195528_TCR-seq_P22-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545992/SRR10545992_1.fastq.gz 
  out=raw/SRR10545992_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545992/SRR10545992_2.fastq.gz 
  out=raw/SRR10545992_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545806/SRR10545806_1.fastq.gz 
  out=raw/SRR10545806_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545806/SRR10545806_2.fastq.gz 
  out=raw/SRR10545806_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545991/SRR10545991_1.fastq.gz 
  out=raw/SRR10545991_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545991/SRR10545991_2.fastq.gz 
  out=raw/SRR10545991_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545807/SRR10545807_1.fastq.gz 
  out=raw/SRR10545807_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545807/SRR10545807_2.fastq.gz 
  out=raw/SRR10545807_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545808/SRR10545808_1.fastq.gz 
  out=raw/SRR10545808_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545808/SRR10545808_2.fastq.gz 
  out=raw/SRR10545808_GSM4195481_TCR-seq_P16-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545989/SRR10545989_1.fastq.gz 
  out=raw/SRR10545989_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545989/SRR10545989_2.fastq.gz 
  out=raw/SRR10545989_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545990/SRR10545990_1.fastq.gz 
  out=raw/SRR10545990_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545990/SRR10545990_2.fastq.gz 
  out=raw/SRR10545990_GSM4195527_TCR-seq_P22-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545988/SRR10545988_1.fastq.gz 
  out=raw/SRR10545988_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545988/SRR10545988_2.fastq.gz 
  out=raw/SRR10545988_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545809/SRR10545809_1.fastq.gz 
  out=raw/SRR10545809_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545809/SRR10545809_2.fastq.gz 
  out=raw/SRR10545809_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545810/SRR10545810_1.fastq.gz 
  out=raw/SRR10545810_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545810/SRR10545810_2.fastq.gz 
  out=raw/SRR10545810_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545987/SRR10545987_1.fastq.gz 
  out=raw/SRR10545987_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545987/SRR10545987_2.fastq.gz 
  out=raw/SRR10545987_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545811/SRR10545811_1.fastq.gz 
  out=raw/SRR10545811_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545811/SRR10545811_2.fastq.gz 
  out=raw/SRR10545811_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545812/SRR10545812_1.fastq.gz 
  out=raw/SRR10545812_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545812/SRR10545812_2.fastq.gz 
  out=raw/SRR10545812_GSM4195482_TCR-seq_P16-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545986/SRR10545986_1.fastq.gz 
  out=raw/SRR10545986_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545986/SRR10545986_2.fastq.gz 
  out=raw/SRR10545986_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545985/SRR10545985_1.fastq.gz 
  out=raw/SRR10545985_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545985/SRR10545985_2.fastq.gz 
  out=raw/SRR10545985_GSM4195526_TCR-seq_P22-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545813/SRR10545813_1.fastq.gz 
  out=raw/SRR10545813_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545813/SRR10545813_2.fastq.gz 
  out=raw/SRR10545813_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545984/SRR10545984_1.fastq.gz 
  out=raw/SRR10545984_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545984/SRR10545984_2.fastq.gz 
  out=raw/SRR10545984_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545814/SRR10545814_1.fastq.gz 
  out=raw/SRR10545814_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545814/SRR10545814_2.fastq.gz 
  out=raw/SRR10545814_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545983/SRR10545983_1.fastq.gz 
  out=raw/SRR10545983_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545983/SRR10545983_2.fastq.gz 
  out=raw/SRR10545983_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545815/SRR10545815_1.fastq.gz 
  out=raw/SRR10545815_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545815/SRR10545815_2.fastq.gz 
  out=raw/SRR10545815_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545982/SRR10545982_1.fastq.gz 
  out=raw/SRR10545982_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545982/SRR10545982_2.fastq.gz 
  out=raw/SRR10545982_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545816/SRR10545816_1.fastq.gz 
  out=raw/SRR10545816_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545816/SRR10545816_2.fastq.gz 
  out=raw/SRR10545816_GSM4195483_TCR-seq_P16-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545817/SRR10545817_1.fastq.gz 
  out=raw/SRR10545817_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545817/SRR10545817_2.fastq.gz 
  out=raw/SRR10545817_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545981/SRR10545981_1.fastq.gz 
  out=raw/SRR10545981_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545981/SRR10545981_2.fastq.gz 
  out=raw/SRR10545981_GSM4195525_TCR-seq_P22-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545980/SRR10545980_1.fastq.gz 
  out=raw/SRR10545980_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545980/SRR10545980_2.fastq.gz 
  out=raw/SRR10545980_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545818/SRR10545818_1.fastq.gz 
  out=raw/SRR10545818_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545818/SRR10545818_2.fastq.gz 
  out=raw/SRR10545818_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545979/SRR10545979_1.fastq.gz 
  out=raw/SRR10545979_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545979/SRR10545979_2.fastq.gz 
  out=raw/SRR10545979_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545819/SRR10545819_1.fastq.gz 
  out=raw/SRR10545819_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545819/SRR10545819_2.fastq.gz 
  out=raw/SRR10545819_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545978/SRR10545978_1.fastq.gz 
  out=raw/SRR10545978_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545978/SRR10545978_2.fastq.gz 
  out=raw/SRR10545978_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545820/SRR10545820_1.fastq.gz 
  out=raw/SRR10545820_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545820/SRR10545820_2.fastq.gz 
  out=raw/SRR10545820_GSM4195484_TCR-seq_P18-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545977/SRR10545977_1.fastq.gz 
  out=raw/SRR10545977_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545977/SRR10545977_2.fastq.gz 
  out=raw/SRR10545977_GSM4195524_TCR-seq_P22-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545821/SRR10545821_1.fastq.gz 
  out=raw/SRR10545821_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545821/SRR10545821_2.fastq.gz 
  out=raw/SRR10545821_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545976/SRR10545976_1.fastq.gz 
  out=raw/SRR10545976_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545976/SRR10545976_2.fastq.gz 
  out=raw/SRR10545976_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545975/SRR10545975_1.fastq.gz 
  out=raw/SRR10545975_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545975/SRR10545975_2.fastq.gz 
  out=raw/SRR10545975_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545822/SRR10545822_1.fastq.gz 
  out=raw/SRR10545822_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545822/SRR10545822_2.fastq.gz 
  out=raw/SRR10545822_GSM4195485_TCR-seq_P18-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545826/SRR10545826_1.fastq.gz 
  out=raw/SRR10545826_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545826/SRR10545826_2.fastq.gz 
  out=raw/SRR10545826_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545974/SRR10545974_1.fastq.gz 
  out=raw/SRR10545974_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545974/SRR10545974_2.fastq.gz 
  out=raw/SRR10545974_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545827/SRR10545827_1.fastq.gz 
  out=raw/SRR10545827_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545827/SRR10545827_2.fastq.gz 
  out=raw/SRR10545827_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545973/SRR10545973_1.fastq.gz 
  out=raw/SRR10545973_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545973/SRR10545973_2.fastq.gz 
  out=raw/SRR10545973_GSM4195523_TCR-seq_P22-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545828/SRR10545828_1.fastq.gz 
  out=raw/SRR10545828_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545828/SRR10545828_2.fastq.gz 
  out=raw/SRR10545828_GSM4195486_TCR-seq_P18-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545972/SRR10545972_1.fastq.gz 
  out=raw/SRR10545972_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545972/SRR10545972_2.fastq.gz 
  out=raw/SRR10545972_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545829/SRR10545829_1.fastq.gz 
  out=raw/SRR10545829_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545829/SRR10545829_2.fastq.gz 
  out=raw/SRR10545829_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545830/SRR10545830_1.fastq.gz 
  out=raw/SRR10545830_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545830/SRR10545830_2.fastq.gz 
  out=raw/SRR10545830_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545971/SRR10545971_1.fastq.gz 
  out=raw/SRR10545971_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545971/SRR10545971_2.fastq.gz 
  out=raw/SRR10545971_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545970/SRR10545970_1.fastq.gz 
  out=raw/SRR10545970_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545970/SRR10545970_2.fastq.gz 
  out=raw/SRR10545970_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545831/SRR10545831_1.fastq.gz 
  out=raw/SRR10545831_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545831/SRR10545831_2.fastq.gz 
  out=raw/SRR10545831_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545969/SRR10545969_1.fastq.gz 
  out=raw/SRR10545969_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545969/SRR10545969_2.fastq.gz 
  out=raw/SRR10545969_GSM4195522_TCR-seq_P22-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545832/SRR10545832_1.fastq.gz 
  out=raw/SRR10545832_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545832/SRR10545832_2.fastq.gz 
  out=raw/SRR10545832_GSM4195487_TCR-seq_P18-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545968/SRR10545968_1.fastq.gz 
  out=raw/SRR10545968_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545968/SRR10545968_2.fastq.gz 
  out=raw/SRR10545968_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545833/SRR10545833_1.fastq.gz 
  out=raw/SRR10545833_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545833/SRR10545833_2.fastq.gz 
  out=raw/SRR10545833_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545834/SRR10545834_1.fastq.gz 
  out=raw/SRR10545834_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545834/SRR10545834_2.fastq.gz 
  out=raw/SRR10545834_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545967/SRR10545967_1.fastq.gz 
  out=raw/SRR10545967_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545967/SRR10545967_2.fastq.gz 
  out=raw/SRR10545967_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545966/SRR10545966_1.fastq.gz 
  out=raw/SRR10545966_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545966/SRR10545966_2.fastq.gz 
  out=raw/SRR10545966_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545835/SRR10545835_1.fastq.gz 
  out=raw/SRR10545835_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545835/SRR10545835_2.fastq.gz 
  out=raw/SRR10545835_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545965/SRR10545965_1.fastq.gz 
  out=raw/SRR10545965_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545965/SRR10545965_2.fastq.gz 
  out=raw/SRR10545965_GSM4195521_TCR-seq_P22-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545836/SRR10545836_1.fastq.gz 
  out=raw/SRR10545836_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545836/SRR10545836_2.fastq.gz 
  out=raw/SRR10545836_GSM4195488_TCR-seq_P18-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545964/SRR10545964_1.fastq.gz 
  out=raw/SRR10545964_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545964/SRR10545964_2.fastq.gz 
  out=raw/SRR10545964_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545837/SRR10545837_1.fastq.gz 
  out=raw/SRR10545837_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545837/SRR10545837_2.fastq.gz 
  out=raw/SRR10545837_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545963/SRR10545963_1.fastq.gz 
  out=raw/SRR10545963_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545963/SRR10545963_2.fastq.gz 
  out=raw/SRR10545963_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545838/SRR10545838_1.fastq.gz 
  out=raw/SRR10545838_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545838/SRR10545838_2.fastq.gz 
  out=raw/SRR10545838_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545962/SRR10545962_1.fastq.gz 
  out=raw/SRR10545962_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545962/SRR10545962_2.fastq.gz 
  out=raw/SRR10545962_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545961/SRR10545961_1.fastq.gz 
  out=raw/SRR10545961_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545961/SRR10545961_2.fastq.gz 
  out=raw/SRR10545961_GSM4195520_TCR-seq_P22-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545839/SRR10545839_1.fastq.gz 
  out=raw/SRR10545839_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545839/SRR10545839_2.fastq.gz 
  out=raw/SRR10545839_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545840/SRR10545840_1.fastq.gz 
  out=raw/SRR10545840_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545840/SRR10545840_2.fastq.gz 
  out=raw/SRR10545840_GSM4195489_TCR-seq_P18-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545960/SRR10545960_1.fastq.gz 
  out=raw/SRR10545960_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545960/SRR10545960_2.fastq.gz 
  out=raw/SRR10545960_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545841/SRR10545841_1.fastq.gz 
  out=raw/SRR10545841_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545841/SRR10545841_2.fastq.gz 
  out=raw/SRR10545841_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545959/SRR10545959_1.fastq.gz 
  out=raw/SRR10545959_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545959/SRR10545959_2.fastq.gz 
  out=raw/SRR10545959_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545842/SRR10545842_1.fastq.gz 
  out=raw/SRR10545842_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545842/SRR10545842_2.fastq.gz 
  out=raw/SRR10545842_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545958/SRR10545958_1.fastq.gz 
  out=raw/SRR10545958_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545958/SRR10545958_2.fastq.gz 
  out=raw/SRR10545958_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545843/SRR10545843_1.fastq.gz 
  out=raw/SRR10545843_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545843/SRR10545843_2.fastq.gz 
  out=raw/SRR10545843_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545844/SRR10545844_1.fastq.gz 
  out=raw/SRR10545844_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545844/SRR10545844_2.fastq.gz 
  out=raw/SRR10545844_GSM4195490_TCR-seq_P18-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545957/SRR10545957_1.fastq.gz 
  out=raw/SRR10545957_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545957/SRR10545957_2.fastq.gz 
  out=raw/SRR10545957_GSM4195519_TCR-seq_P21-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545956/SRR10545956_1.fastq.gz 
  out=raw/SRR10545956_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545956/SRR10545956_2.fastq.gz 
  out=raw/SRR10545956_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545845/SRR10545845_1.fastq.gz 
  out=raw/SRR10545845_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545845/SRR10545845_2.fastq.gz 
  out=raw/SRR10545845_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545955/SRR10545955_1.fastq.gz 
  out=raw/SRR10545955_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545955/SRR10545955_2.fastq.gz 
  out=raw/SRR10545955_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545846/SRR10545846_1.fastq.gz 
  out=raw/SRR10545846_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545846/SRR10545846_2.fastq.gz 
  out=raw/SRR10545846_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545954/SRR10545954_1.fastq.gz 
  out=raw/SRR10545954_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545954/SRR10545954_2.fastq.gz 
  out=raw/SRR10545954_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545953/SRR10545953_1.fastq.gz 
  out=raw/SRR10545953_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545953/SRR10545953_2.fastq.gz 
  out=raw/SRR10545953_GSM4195518_TCR-seq_P21-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545847/SRR10545847_1.fastq.gz 
  out=raw/SRR10545847_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545847/SRR10545847_2.fastq.gz 
  out=raw/SRR10545847_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545952/SRR10545952_1.fastq.gz 
  out=raw/SRR10545952_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545952/SRR10545952_2.fastq.gz 
  out=raw/SRR10545952_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545848/SRR10545848_1.fastq.gz 
  out=raw/SRR10545848_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545848/SRR10545848_2.fastq.gz 
  out=raw/SRR10545848_GSM4195491_TCR-seq_P18-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545849/SRR10545849_1.fastq.gz 
  out=raw/SRR10545849_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545849/SRR10545849_2.fastq.gz 
  out=raw/SRR10545849_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545951/SRR10545951_1.fastq.gz 
  out=raw/SRR10545951_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545951/SRR10545951_2.fastq.gz 
  out=raw/SRR10545951_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545850/SRR10545850_1.fastq.gz 
  out=raw/SRR10545850_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545850/SRR10545850_2.fastq.gz 
  out=raw/SRR10545850_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545950/SRR10545950_1.fastq.gz 
  out=raw/SRR10545950_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/050/SRR10545950/SRR10545950_2.fastq.gz 
  out=raw/SRR10545950_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545852/SRR10545852_1.fastq.gz 
  out=raw/SRR10545852_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/052/SRR10545852/SRR10545852_2.fastq.gz 
  out=raw/SRR10545852_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545851/SRR10545851_1.fastq.gz 
  out=raw/SRR10545851_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/051/SRR10545851/SRR10545851_2.fastq.gz 
  out=raw/SRR10545851_GSM4195492_TCR-seq_P18-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545949/SRR10545949_1.fastq.gz 
  out=raw/SRR10545949_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/049/SRR10545949/SRR10545949_2.fastq.gz 
  out=raw/SRR10545949_GSM4195517_TCR-seq_P21-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545948/SRR10545948_1.fastq.gz 
  out=raw/SRR10545948_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/048/SRR10545948/SRR10545948_2.fastq.gz 
  out=raw/SRR10545948_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545853/SRR10545853_1.fastq.gz 
  out=raw/SRR10545853_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/053/SRR10545853/SRR10545853_2.fastq.gz 
  out=raw/SRR10545853_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545947/SRR10545947_1.fastq.gz 
  out=raw/SRR10545947_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/047/SRR10545947/SRR10545947_2.fastq.gz 
  out=raw/SRR10545947_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545854/SRR10545854_1.fastq.gz 
  out=raw/SRR10545854_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/054/SRR10545854/SRR10545854_2.fastq.gz 
  out=raw/SRR10545854_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545946/SRR10545946_1.fastq.gz 
  out=raw/SRR10545946_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/046/SRR10545946/SRR10545946_2.fastq.gz 
  out=raw/SRR10545946_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545855/SRR10545855_1.fastq.gz 
  out=raw/SRR10545855_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/055/SRR10545855/SRR10545855_2.fastq.gz 
  out=raw/SRR10545855_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545945/SRR10545945_1.fastq.gz 
  out=raw/SRR10545945_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/045/SRR10545945/SRR10545945_2.fastq.gz 
  out=raw/SRR10545945_GSM4195516_TCR-seq_P21-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545944/SRR10545944_1.fastq.gz 
  out=raw/SRR10545944_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/044/SRR10545944/SRR10545944_2.fastq.gz 
  out=raw/SRR10545944_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545856/SRR10545856_1.fastq.gz 
  out=raw/SRR10545856_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/056/SRR10545856/SRR10545856_2.fastq.gz 
  out=raw/SRR10545856_GSM4195493_TCR-seq_P18-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545857/SRR10545857_1.fastq.gz 
  out=raw/SRR10545857_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/057/SRR10545857/SRR10545857_2.fastq.gz 
  out=raw/SRR10545857_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545943/SRR10545943_1.fastq.gz 
  out=raw/SRR10545943_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/043/SRR10545943/SRR10545943_2.fastq.gz 
  out=raw/SRR10545943_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545858/SRR10545858_1.fastq.gz 
  out=raw/SRR10545858_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/058/SRR10545858/SRR10545858_2.fastq.gz 
  out=raw/SRR10545858_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545942/SRR10545942_1.fastq.gz 
  out=raw/SRR10545942_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/042/SRR10545942/SRR10545942_2.fastq.gz 
  out=raw/SRR10545942_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545859/SRR10545859_1.fastq.gz 
  out=raw/SRR10545859_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/059/SRR10545859/SRR10545859_2.fastq.gz 
  out=raw/SRR10545859_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545941/SRR10545941_1.fastq.gz 
  out=raw/SRR10545941_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/041/SRR10545941/SRR10545941_2.fastq.gz 
  out=raw/SRR10545941_GSM4195515_TCR-seq_P21-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545860/SRR10545860_1.fastq.gz 
  out=raw/SRR10545860_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/060/SRR10545860/SRR10545860_2.fastq.gz 
  out=raw/SRR10545860_GSM4195494_TCR-seq_P18-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545940/SRR10545940_1.fastq.gz 
  out=raw/SRR10545940_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/040/SRR10545940/SRR10545940_2.fastq.gz 
  out=raw/SRR10545940_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545861/SRR10545861_1.fastq.gz 
  out=raw/SRR10545861_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/061/SRR10545861/SRR10545861_2.fastq.gz 
  out=raw/SRR10545861_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545939/SRR10545939_1.fastq.gz 
  out=raw/SRR10545939_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/039/SRR10545939/SRR10545939_2.fastq.gz 
  out=raw/SRR10545939_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545862/SRR10545862_1.fastq.gz 
  out=raw/SRR10545862_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/062/SRR10545862/SRR10545862_2.fastq.gz 
  out=raw/SRR10545862_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545938/SRR10545938_1.fastq.gz 
  out=raw/SRR10545938_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/038/SRR10545938/SRR10545938_2.fastq.gz 
  out=raw/SRR10545938_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545863/SRR10545863_1.fastq.gz 
  out=raw/SRR10545863_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/063/SRR10545863/SRR10545863_2.fastq.gz 
  out=raw/SRR10545863_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545937/SRR10545937_1.fastq.gz 
  out=raw/SRR10545937_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/037/SRR10545937/SRR10545937_2.fastq.gz 
  out=raw/SRR10545937_GSM4195514_TCR-seq_P21-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545864/SRR10545864_1.fastq.gz 
  out=raw/SRR10545864_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/064/SRR10545864/SRR10545864_2.fastq.gz 
  out=raw/SRR10545864_GSM4195495_TCR-seq_P18-M2-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545865/SRR10545865_1.fastq.gz 
  out=raw/SRR10545865_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/065/SRR10545865/SRR10545865_2.fastq.gz 
  out=raw/SRR10545865_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545936/SRR10545936_1.fastq.gz 
  out=raw/SRR10545936_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/036/SRR10545936/SRR10545936_2.fastq.gz 
  out=raw/SRR10545936_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545935/SRR10545935_1.fastq.gz 
  out=raw/SRR10545935_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/035/SRR10545935/SRR10545935_2.fastq.gz 
  out=raw/SRR10545935_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545866/SRR10545866_1.fastq.gz 
  out=raw/SRR10545866_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/066/SRR10545866/SRR10545866_2.fastq.gz 
  out=raw/SRR10545866_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545934/SRR10545934_1.fastq.gz 
  out=raw/SRR10545934_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/034/SRR10545934/SRR10545934_2.fastq.gz 
  out=raw/SRR10545934_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545867/SRR10545867_1.fastq.gz 
  out=raw/SRR10545867_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/067/SRR10545867/SRR10545867_2.fastq.gz 
  out=raw/SRR10545867_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545933/SRR10545933_1.fastq.gz 
  out=raw/SRR10545933_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/033/SRR10545933/SRR10545933_2.fastq.gz 
  out=raw/SRR10545933_GSM4195513_TCR-seq_P21-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545868/SRR10545868_1.fastq.gz 
  out=raw/SRR10545868_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/068/SRR10545868/SRR10545868_2.fastq.gz 
  out=raw/SRR10545868_GSM4195496_TCR-seq_P19-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545932/SRR10545932_1.fastq.gz 
  out=raw/SRR10545932_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/032/SRR10545932/SRR10545932_2.fastq.gz 
  out=raw/SRR10545932_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545869/SRR10545869_1.fastq.gz 
  out=raw/SRR10545869_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/069/SRR10545869/SRR10545869_2.fastq.gz 
  out=raw/SRR10545869_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545931/SRR10545931_1.fastq.gz 
  out=raw/SRR10545931_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/031/SRR10545931/SRR10545931_2.fastq.gz 
  out=raw/SRR10545931_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545870/SRR10545870_1.fastq.gz 
  out=raw/SRR10545870_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/070/SRR10545870/SRR10545870_2.fastq.gz 
  out=raw/SRR10545870_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545871/SRR10545871_1.fastq.gz 
  out=raw/SRR10545871_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/071/SRR10545871/SRR10545871_2.fastq.gz 
  out=raw/SRR10545871_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545930/SRR10545930_1.fastq.gz 
  out=raw/SRR10545930_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/030/SRR10545930/SRR10545930_2.fastq.gz 
  out=raw/SRR10545930_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545925/SRR10545925_1.fastq.gz 
  out=raw/SRR10545925_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/025/SRR10545925/SRR10545925_2.fastq.gz 
  out=raw/SRR10545925_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545929/SRR10545929_1.fastq.gz 
  out=raw/SRR10545929_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/029/SRR10545929/SRR10545929_2.fastq.gz 
  out=raw/SRR10545929_GSM4195512_TCR-seq_P21-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545876/SRR10545876_1.fastq.gz 
  out=raw/SRR10545876_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/076/SRR10545876/SRR10545876_2.fastq.gz 
  out=raw/SRR10545876_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545872/SRR10545872_1.fastq.gz 
  out=raw/SRR10545872_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/072/SRR10545872/SRR10545872_2.fastq.gz 
  out=raw/SRR10545872_GSM4195497_TCR-seq_P19-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545924/SRR10545924_1.fastq.gz 
  out=raw/SRR10545924_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/024/SRR10545924/SRR10545924_2.fastq.gz 
  out=raw/SRR10545924_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545928/SRR10545928_1.fastq.gz 
  out=raw/SRR10545928_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/028/SRR10545928/SRR10545928_2.fastq.gz 
  out=raw/SRR10545928_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545877/SRR10545877_1.fastq.gz 
  out=raw/SRR10545877_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/077/SRR10545877/SRR10545877_2.fastq.gz 
  out=raw/SRR10545877_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545873/SRR10545873_1.fastq.gz 
  out=raw/SRR10545873_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/073/SRR10545873/SRR10545873_2.fastq.gz 
  out=raw/SRR10545873_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545923/SRR10545923_1.fastq.gz 
  out=raw/SRR10545923_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/023/SRR10545923/SRR10545923_2.fastq.gz 
  out=raw/SRR10545923_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545927/SRR10545927_1.fastq.gz 
  out=raw/SRR10545927_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/027/SRR10545927/SRR10545927_2.fastq.gz 
  out=raw/SRR10545927_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545878/SRR10545878_1.fastq.gz 
  out=raw/SRR10545878_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/078/SRR10545878/SRR10545878_2.fastq.gz 
  out=raw/SRR10545878_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545874/SRR10545874_1.fastq.gz 
  out=raw/SRR10545874_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/074/SRR10545874/SRR10545874_2.fastq.gz 
  out=raw/SRR10545874_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545922/SRR10545922_1.fastq.gz 
  out=raw/SRR10545922_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/022/SRR10545922/SRR10545922_2.fastq.gz 
  out=raw/SRR10545922_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545926/SRR10545926_1.fastq.gz 
  out=raw/SRR10545926_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/026/SRR10545926/SRR10545926_2.fastq.gz 
  out=raw/SRR10545926_GSM4195511_TCR-seq_P21-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545879/SRR10545879_1.fastq.gz 
  out=raw/SRR10545879_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/079/SRR10545879/SRR10545879_2.fastq.gz 
  out=raw/SRR10545879_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545875/SRR10545875_1.fastq.gz 
  out=raw/SRR10545875_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/075/SRR10545875/SRR10545875_2.fastq.gz 
  out=raw/SRR10545875_GSM4195498_TCR-seq_P19-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545921/SRR10545921_1.fastq.gz 
  out=raw/SRR10545921_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/021/SRR10545921/SRR10545921_2.fastq.gz 
  out=raw/SRR10545921_GSM4195510_TCR-seq_P21-T0-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545880/SRR10545880_1.fastq.gz 
  out=raw/SRR10545880_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/080/SRR10545880/SRR10545880_2.fastq.gz 
  out=raw/SRR10545880_GSM4195499_TCR-seq_P19-T0-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545920/SRR10545920_1.fastq.gz 
  out=raw/SRR10545920_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/020/SRR10545920/SRR10545920_2.fastq.gz 
  out=raw/SRR10545920_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545881/SRR10545881_1.fastq.gz 
  out=raw/SRR10545881_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/081/SRR10545881/SRR10545881_2.fastq.gz 
  out=raw/SRR10545881_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545919/SRR10545919_1.fastq.gz 
  out=raw/SRR10545919_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/019/SRR10545919/SRR10545919_2.fastq.gz 
  out=raw/SRR10545919_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545882/SRR10545882_1.fastq.gz 
  out=raw/SRR10545882_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/082/SRR10545882/SRR10545882_2.fastq.gz 
  out=raw/SRR10545882_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545918/SRR10545918_1.fastq.gz 
  out=raw/SRR10545918_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/018/SRR10545918/SRR10545918_2.fastq.gz 
  out=raw/SRR10545918_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545883/SRR10545883_1.fastq.gz 
  out=raw/SRR10545883_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/083/SRR10545883/SRR10545883_2.fastq.gz 
  out=raw/SRR10545883_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545917/SRR10545917_1.fastq.gz 
  out=raw/SRR10545917_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/017/SRR10545917/SRR10545917_2.fastq.gz 
  out=raw/SRR10545917_GSM4195509_TCR-seq_P21-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545884/SRR10545884_1.fastq.gz 
  out=raw/SRR10545884_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/084/SRR10545884/SRR10545884_2.fastq.gz 
  out=raw/SRR10545884_GSM4195500_TCR-seq_P19-M1-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545916/SRR10545916_1.fastq.gz 
  out=raw/SRR10545916_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/016/SRR10545916/SRR10545916_2.fastq.gz 
  out=raw/SRR10545916_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545885/SRR10545885_1.fastq.gz 
  out=raw/SRR10545885_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/085/SRR10545885/SRR10545885_2.fastq.gz 
  out=raw/SRR10545885_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545915/SRR10545915_1.fastq.gz 
  out=raw/SRR10545915_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/015/SRR10545915/SRR10545915_2.fastq.gz 
  out=raw/SRR10545915_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545886/SRR10545886_1.fastq.gz 
  out=raw/SRR10545886_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/086/SRR10545886/SRR10545886_2.fastq.gz 
  out=raw/SRR10545886_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545914/SRR10545914_1.fastq.gz 
  out=raw/SRR10545914_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/014/SRR10545914/SRR10545914_2.fastq.gz 
  out=raw/SRR10545914_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545887/SRR10545887_1.fastq.gz 
  out=raw/SRR10545887_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/087/SRR10545887/SRR10545887_2.fastq.gz 
  out=raw/SRR10545887_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545913/SRR10545913_1.fastq.gz 
  out=raw/SRR10545913_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/013/SRR10545913/SRR10545913_2.fastq.gz 
  out=raw/SRR10545913_GSM4195508_TCR-seq_P21-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545888/SRR10545888_1.fastq.gz 
  out=raw/SRR10545888_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/088/SRR10545888/SRR10545888_2.fastq.gz 
  out=raw/SRR10545888_GSM4195501_TCR-seq_P19-M1-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545912/SRR10545912_1.fastq.gz 
  out=raw/SRR10545912_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/012/SRR10545912/SRR10545912_2.fastq.gz 
  out=raw/SRR10545912_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545889/SRR10545889_1.fastq.gz 
  out=raw/SRR10545889_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/089/SRR10545889/SRR10545889_2.fastq.gz 
  out=raw/SRR10545889_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545911/SRR10545911_1.fastq.gz 
  out=raw/SRR10545911_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/011/SRR10545911/SRR10545911_2.fastq.gz 
  out=raw/SRR10545911_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545890/SRR10545890_1.fastq.gz 
  out=raw/SRR10545890_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/090/SRR10545890/SRR10545890_2.fastq.gz 
  out=raw/SRR10545890_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545910/SRR10545910_1.fastq.gz 
  out=raw/SRR10545910_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/010/SRR10545910/SRR10545910_2.fastq.gz 
  out=raw/SRR10545910_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545891/SRR10545891_1.fastq.gz 
  out=raw/SRR10545891_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/091/SRR10545891/SRR10545891_2.fastq.gz 
  out=raw/SRR10545891_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545909/SRR10545909_1.fastq.gz 
  out=raw/SRR10545909_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/009/SRR10545909/SRR10545909_2.fastq.gz 
  out=raw/SRR10545909_GSM4195507_TCR-seq_P19-M2PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545892/SRR10545892_1.fastq.gz 
  out=raw/SRR10545892_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/092/SRR10545892/SRR10545892_2.fastq.gz 
  out=raw/SRR10545892_GSM4195502_TCR-seq_P19-M1-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545908/SRR10545908_1.fastq.gz 
  out=raw/SRR10545908_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/008/SRR10545908/SRR10545908_2.fastq.gz 
  out=raw/SRR10545908_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545893/SRR10545893_1.fastq.gz 
  out=raw/SRR10545893_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/093/SRR10545893/SRR10545893_2.fastq.gz 
  out=raw/SRR10545893_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545907/SRR10545907_1.fastq.gz 
  out=raw/SRR10545907_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/007/SRR10545907/SRR10545907_2.fastq.gz 
  out=raw/SRR10545907_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545894/SRR10545894_1.fastq.gz 
  out=raw/SRR10545894_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/094/SRR10545894/SRR10545894_2.fastq.gz 
  out=raw/SRR10545894_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545906/SRR10545906_1.fastq.gz 
  out=raw/SRR10545906_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/006/SRR10545906/SRR10545906_2.fastq.gz 
  out=raw/SRR10545906_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545895/SRR10545895_1.fastq.gz 
  out=raw/SRR10545895_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/095/SRR10545895/SRR10545895_2.fastq.gz 
  out=raw/SRR10545895_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545905/SRR10545905_1.fastq.gz 
  out=raw/SRR10545905_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/005/SRR10545905/SRR10545905_2.fastq.gz 
  out=raw/SRR10545905_GSM4195506_TCR-seq_P19-M2-DNEG_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545896/SRR10545896_1.fastq.gz 
  out=raw/SRR10545896_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/096/SRR10545896/SRR10545896_2.fastq.gz 
  out=raw/SRR10545896_GSM4195503_TCR-seq_P19-M1-PD1_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545904/SRR10545904_1.fastq.gz 
  out=raw/SRR10545904_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/004/SRR10545904/SRR10545904_2.fastq.gz 
  out=raw/SRR10545904_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545897/SRR10545897_1.fastq.gz 
  out=raw/SRR10545897_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/097/SRR10545897/SRR10545897_2.fastq.gz 
  out=raw/SRR10545897_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545903/SRR10545903_1.fastq.gz 
  out=raw/SRR10545903_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/003/SRR10545903/SRR10545903_2.fastq.gz 
  out=raw/SRR10545903_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545898/SRR10545898_1.fastq.gz 
  out=raw/SRR10545898_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/098/SRR10545898/SRR10545898_2.fastq.gz 
  out=raw/SRR10545898_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545902/SRR10545902_1.fastq.gz 
  out=raw/SRR10545902_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/002/SRR10545902/SRR10545902_2.fastq.gz 
  out=raw/SRR10545902_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545899/SRR10545899_1.fastq.gz 
  out=raw/SRR10545899_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/099/SRR10545899/SRR10545899_2.fastq.gz 
  out=raw/SRR10545899_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545901/SRR10545901_1.fastq.gz 
  out=raw/SRR10545901_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/001/SRR10545901/SRR10545901_2.fastq.gz 
  out=raw/SRR10545901_GSM4195505_TCR-seq_P19-M2-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545900/SRR10545900_1.fastq.gz 
  out=raw/SRR10545900_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR105/000/SRR10545900/SRR10545900_2.fastq.gz 
  out=raw/SRR10545900_GSM4195504_TCR-seq_P19-M2-DPOS_Homo_sapiens_OTHER_2.fastq.gz

The project contains 544 paired fastq files, separated in multiple lanes and biosample ids:

> ls raw/

SRR10545725_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
SRR10545725_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
SRR10545726_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
SRR10545726_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
SRR10545727_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
SRR10545727_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
SRR10545728_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz
SRR10545728_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz
...

Each file name encodes the information about lane, biosample id, metadata, R1 or R2. For example for the first file from above listing:

  • SRR10545497 - lane
  • GSM4195404 - biosample id
  • P5 - patient id
  • T0 - time point
  • DPOS - double positive
  • OTHER_1 - first mate of paired-end data.

Upstream analysis

The most straightforward way to get clonotype tables is to use a universal mixcr analyze command with generic-tcr-amplicon-umi preset.

According to the library preparation protocol, the library has V primers on 5'-end and C primers on 3', so the command for a single sample is the following:

mixcr analyze generic-tcr-amplicon-umi \
    --species hsa \
    --rna \
    --rigid-left-alignment-boundary \
    --floating-right-alignment-boundary C \
    --tag-pattern '^(R1:*)\^(UMI:N{12})' \
    raw/SRR{{n}}_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz \
    raw/SRR{{n}}_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz \
    results/P15-T0-TIGIT

The meaning of these options is the following.

--species
is set to hsa for Homo Sapience
--rna
affects the choice of V gene region which will be used as target in align step (vParameters.geneFeatureToAlign, see align documentation): --rna corresponds to the VTranscriptWithP and --dna to VGeneWithP (see Gene features and anchor points for details)
--rigid-left-alignment-boundary
MiXCR will use global alignment algorithm to align the left bound of V.
--floating-right-alignment-boundary C
MiXCR will use global alignment algorithms to align the right bound of J gene and local alignment algorithms to align the right bound of C gene segments due to the presence of primer sequences.
--tag-pattern
is used to specify UMI pattern for the library. MiXCR provides a powerful regex-like language allowing to specify almost arbitrary barcode structure. Here we use ^(R1:*)\^(UMI:N{12}) pattern to specify that R1 should be used as is, UMI spans the first 12 letters of R2 and the rest of R2 is ignored.

Finally, we specify paths for both input files and a path to output folder with prefix describing the sample. Note that {{n}} syntax is similar to Linux wildcard behaviour: it will concatenate all fastq files matching this pattern into one sample. This is very useful when you have for example multiple lanes.

Running the command above will generate the following files:

> ls results/

# human-readable reports 
P15-T0-TIGIT.align.report.txt
P15-T0-TIGIT.align.report.json
P15-T0-TIGIT.refine.report.txt
P15-T0-TIGIT.refine.report.json
P15-T0-TIGIT.assemble.report.txt
P15-T0-TIGIT.assemble.report.json

# raw alignments (highly compressed binary file)
P15-T0-TIGIT.vdjca
# alignments with corrected UMI barcode sequences 
P15-T0-TIGIT.refined.vdjca
# TCRα & TCRβ CDR3 clonotypes (highly compressed binary file)
P15-T0-TIGIT.clns
# TCRα & TCRβ CDR3 clonotypes exported in tab-delimited txt
P15-T0-TIGIT.clonotypes.TRA.txt
P15-T0-TIGIT.clonotypes.TRB.txt  

Clonotype tables is the main result of the upstream analysis. They are stored in a highly compressed and efficient binary .clns file and can be exported in many ways: detailed tab-delimited format with dozens of customizable columns, human readable for manual inspection, and AIRR format suitable for many scientific downstream analysis tools. By default, MiXCR exports clonotypes in a tab-delimited format separately for each immunological chain.

In order to run the analysis for all samples in the project on Linux we can for example use GNU Parallel in the following way:

#!/usr/bin/env bash

mkdir -p results

ls raw/*_1* | \
  sed 's:SRR[0-9]*_:SRR\{\{n\}\}_:g' | \
  uniq | \
  parallel -j2 --line-buffer \
  'mixcr analyze generic-tcr-amplicon-umi -f \
    --species hsa \
    --rna \
    --rigid-left-alignment-boundary \
    --floating-right-alignment-boundary C \
    --tag-pattern '^(R1:*)\^(UMI:N{12})' \
    {} \
    {=s:OTHER_1:OTHER_2:=} \
    results/{=s:.*TCR-seq_::; s:_Homo.*::=}'

Briefly, we list all R1 files in the fastq directory, replace lane specifications with MiXCR {{n}} wildcard, pipe the list to parallel, then run mixcr analyze for each pair, again using sed to obtain R2 filename from R1 and the name of output.

Details and fine-tuning

Under the hood, mixcr analyze generic-tcr-amplicon-umi executes the following pipeline of MiXCR actions:

pipeline

Each step in this pipeline is executed with a specific options inherited from the options supplied to mixcr analyze generic-tcr-amplicon-umi. Instead of running analyze one can run the whole pipeline step by step and additionally fine tune the analysis parameters at each step. Another reason why sometimes it is better to execute the pipeline step by step is the ability to better manage hardware resources allocated to each step, because some steps are memory intensive and less CPU intensive, while others are vice a versa.

Let's go throw each step executed in the considered case.

align

Performs:

  • alignment of raw sequencing reads against reference database of V-, D-, J- and C- gene segments
  • pattern matching of tag pattern sequence and extraction of barcodes
mixcr align \
    -p bundle-umi-kaligner1-v1-base \
    --species hsa \
    --tag-pattern '^(R1:*)\^(UMI:N{12})' \
    --report result/P15-T0-TIGIT.align.report.txt \
    --json-report result/P15-T0-TIGIT.align.report.json \
    -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \
    -OvParameters.parameters.floatingLeftBound=false \
    -OjParameters.parameters.floatingRightBound=false \
    -OcParameters.parameters.floatingRightBound=true \
    raw/SRR{{n}}_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_1.fastq.gz \
    raw/SRR{{n}}_GSM4195461_TCR-seq_P15-T0-TIGIT_Homo_sapiens_OTHER_2.fastq.gz \
    results/P15-T0-TIGIT.vdjca

Options --report and --json-report are specified here explicitly. Since we start from RNA data we use VTranscriptWithP for the alignment of V segments (see Gene features and anchor points. Because we have primers on V segment, we use local alignment on the left bound of V and since we have primers on C segment, we use global alignment for J and local on the right bound of C.

-p bundle-umi-kaligner1-v1-base
this preset defines parameters for aligner and for subsequent steps also including UMI related options.

This step utilizes all available CPUs and scales perfectly. When there are a lot of CPUs, the only limiting factor is the speed of disk I/O. To limit the number of used CPUs one can pass --threads N option.

refineTagsAndSort

Corrects sequencing and PCR errors inside barcode sequences. This step does extremely important job by correcting artificial diversity caused by errors in barcodes. In the considered example project it corrects only sequences of UMIs.

mixcr refineTagsAndSort \
    --report results/P15-T0-TIGIT.refine.report.txt \
    --json-report results/P15-T0-TIGIT.refine.report.json \
    results/P15-T0-TIGIT.vdjca \
    results/P15-T0-TIGIT.refined.vdjca

Options --report and --json-report are specified here explicitly so that the report files will be appended with the barcode correction report.

assemble

Assembles clonotypes and applies several layers of errors correction. In the current example project we consider TCRα & TCRβ separately and clonotype by its CDR3 sequence. The layers of correction applied in this example are:

  • assembly consensus CDR3 sequence for each UMI
  • quality-awared correction for sequencing errors
  • clustering to correct for PCR errors, which still may present even in the case of UMI data, since a error may be introduced e.g. on the first reverse-transcription cycle
mixcr assemble \
    --report results/P15-T0-TIGIT.assemble.report.txt \
    --json-report results/P15-T0-TIGIT.assemble.report.json \
    results/P15-T0-TIGIT.refined.vdjca \
    results/P15-T0-TIGIT.clns

Options --report and --json-report are specified here explicitly so that the report files will be appended with assembly report.

Assembly step may be quite memory consuming for very big datasets. MiXCR offloads memory intensive computations to disk and does it in a highly efficient and parallelized way, fully utilizing all hardware facilities. For such big samples it may be worth to control the amount of RAM provided to MiXCR using -Xmx JVM option (the more RAM supplied the faster execution):

> mixcr -Xmx16g assemble ...

exportClones

Finally, to export clonotype tables in tabular form exportClones is used:

mixcr exportClones \
     --chains TRA \
     results/P15-T0-TIGIT.clns \
     results/P15-T0-TIGIT.TRA.tsv

The resulting clonotype table will contain exhaustive information about each clonotype:

cloneId cloneCount cloneFraction targetSequences targetQualities allVHitsWithScore allDHitsWithScore allJHitsWithScore allCHitsWithScore allVAlignments allDAlignments allJAlignments allCAlignments nSeqFR1 minQualFR1 nSeqCDR1 minQualCDR1 nSeqFR2 minQualFR2 nSeqCDR2 minQualCDR2 nSeqFR3 minQualFR3 nSeqCDR3 minQualCDR3 nSeqFR4 minQualFR4 aaSeqFR1 aaSeqCDR1 aaSeqFR2 aaSeqCDR2 aaSeqFR3 aaSeqCDR3 aaSeqFR4 refPoints uniqueTagCountUMI
0 195302 0.415599 TGTGCCGTGAACTCTGGCAACACAGGCAAACTAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(513.6) nan TRAJ37*00(287.1) TRAC*00(250.4) 429 441 462 0 12 60.0 nan 23 51 82 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACTCTGGCAACACAGGCAAACTAATCTTT
1 76308 0.162382 TGTGTGGTGAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(542.8) nan TRAJ27*00(277.5) TRAC*00(247.4) 423 436 456 0 13 65.0 nan 21 48 79 9 36 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAACACCAATGCAGGCAAATCAACCTTT
3 22128 0.047088 TGTGCTGTGCAGGCATCTAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(523.7) nan TRAJ48*00(299.3) TRAC*00(246.7) 423 437 456 0 14 70.0 nan 21 52 83 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGCAGGCATCTAACTTTGGAAATGAGAAATTAACCTTT
See full clonotype table for P15-T0-TIGIT:
cloneId cloneCount cloneFraction targetSequences targetQualities allVHitsWithScore allDHitsWithScore allJHitsWithScore allCHitsWithScore allVAlignments allDAlignments allJAlignments allCAlignments nSeqFR1 minQualFR1 nSeqCDR1 minQualCDR1 nSeqFR2 minQualFR2 nSeqCDR2 minQualCDR2 nSeqFR3 minQualFR3 nSeqCDR3 minQualCDR3 nSeqFR4 minQualFR4 aaSeqFR1 aaSeqCDR1 aaSeqFR2 aaSeqCDR2 aaSeqFR3 aaSeqCDR3 aaSeqFR4 refPoints uniqueTagCountUMI
0 195302 0.415599 TGTGCCGTGAACTCTGGCAACACAGGCAAACTAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(513.6) nan TRAJ37*00(287.1) TRAC*00(250.4) 429 441 462 0 12 60.0 nan 23 51 82 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACTCTGGCAACACAGGCAAACTAATCTTT
1 76308 0.162382 TGTGTGGTGAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(542.8) nan TRAJ27*00(277.5) TRAC*00(247.4) 423 436 456 0 13 65.0 nan 21 48 79 9 36 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAACACCAATGCAGGCAAATCAACCTTT
3 22128 0.047088 TGTGCTGTGCAGGCATCTAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(523.7) nan TRAJ48*00(299.3) TRAC*00(246.7) 423 437 456 0 14 70.0 nan 21 52 83 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGCAGGCATCTAACTTTGGAAATGAGAAATTAACCTTT
9 5528 0.0117635 TGTGCTACGGACGCGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(477.6) nan TRAJ45*00(303.8) TRAC*00(253.8) 423 438 456 0 15 75.0 nan 23 55 86 16 48 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGCGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT
10 4622 0.00983553 TGTGCTCCCGTTTACGCCAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(499.3) nan TRAJ21*00(255.9) TRAC*00(252.1) 432 439 469 0 7 35.0 nan 22 44 75 17 39 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCCCGTTTACGCCAACTTCAACAAATTTTACTTT
11 4097 0.00871834 TGTGCTCTGAACCTCTATAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(468.5) nan TRAJ34*00(261.5) TRAC*00(253.2) 432 442 469 0 10 50.0 nan 23 47 78 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAACCTCTATAACACCGACAAGCTCATCTTT
18 2687 0.00571789 TGTGCCGTGAACGGCCGAGACCTAAAGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(503.9) nan TRAJ10*00(273.4) TRAC*00(238.3) 429 441 462 0 12 60.0 nan 28 53 84 26 51 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACGGCCGAGACCTAAAGGGAGGAGGAAACAAACTCACCTTT
21 2492 0.00530293 TGTGCAGCAAGCGCGGGTAATAATGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(514.3) nan TRAJ39*00(287.2) TRAC*00(202.3) 444 459 477 0 15 75.0 nan 24 52 83 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGCGGGTAATAATGCAGGCAACATGCTCACCTTT
22 2440 0.00519227 TGTGCTGTGGCAGGGGGATCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(525.2) nan TRAJ45*00(296.7) TRAC*00(215.1) 423 432 456 0 9 45.0 nan 25 55 86 18 48 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGCAGGGGGATCAGGAGGAGGTGCTGACGGACTCACCTTT
26 2157 0.00459006 TGTGTGGTGACCCCTACCAACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV10*00(567.5) nan TRAJ20*00(255.6) TRAC*00(224) 429 439 462 0 10 50.0 nan 25 46 77 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGACCCCTACCAACGACTACAAGCTCAGCTTT
27 2105 0.0044794 TGTGCTACGGACGTTGATTCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(480.3) nan TRAJ45*00(305.4) TRAC*00(240.2) 423 436 456 0 13 65.0 nan 23 55 86 16 48 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGTTGATTCAGGAGGAGGTGCTGACGGACTCACCTTT
28 2099 0.00446663 TGTGCTGGCCGCCCTCTTAAATATTATGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV35*00(497.9) nan TRAJ32*00(305.2) TRAC*00(278.7) 417 425 449 0 8 40.0 nan 23 55 86 22 54 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGGCCGCCCTCTTAAATATTATGGTGGTGCTACAAACAAGCTCATCTTT
32 1936 0.00411977 TGTGGCACGGGAGATCAAGGGGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV30*00(466.5) nan TRAJ42*00(266.7) TRAC*00(251.1) 423 431 456 0 8 SC425T 24.0 nan 31 55 86 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGGCACGGGAGATCAAGGGGGAAGCCAAGGAAATCTCATCTTT
39 1673 0.00356011 TGTGCTGTGGACACCTCCTACGACAAGGTGATATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV22*00(535.8) nan TRAJ50*00(265.7) TRAC*00(249.5) 417 428 450 0 11 55.0 nan 25 49 80 12 36 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGACACCTCCTACGACAAGGTGATATTT
40 1665 0.00354309 TGTGCCGTGATTGGGGCTAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(441.8) nan TRAJ33*00(259.4) TRAC*00(259.5) 429 439 462 0 10 50.0 nan 24 46 77 17 39 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGATTGGGGCTAGCAACTATCAGTTAATCTGG
41 1631 0.00347074 TGTGCCGTGAACGGGGCTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(550) nan TRAJ9*00(265.1) TRAC*00(260.8) 429 441 462 0 12 60.0 nan 27 50 81 16 39 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACGGGGCTGGAGGCTTCAAAACTATCTTT
44 1522 0.00323879 TGTGCTACGGACGCTAAACCTGGAGCCAATAGTAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(591.8) nan TRAJ56*00(277.5) TRAC*00(227) 423 437 456 0 14 70.0 nan 25 51 82 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGCTAAACCTGGAGCCAATAGTAAGCTGACATTT
48 1433 0.0030494 TGTGCTGTGGGTGCGAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-3*00(596.6) nan TRAJ26*00(265.2) TRAC*00(240.6) 426 441 460 0 15 75.0 nan 25 49 80 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGGTGCGAACTATGGTCAGAATTTTGTCTTT
49 1368 0.00291108 TGTGCTGTGGGCCTCTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV22*00(538.3) nan TRAJ21*00(238.4) TRAC*00(261.2) 417 427 450 0 10 50.0 nan 25 44 75 14 33 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGGCCTCTTCAACAAATTTTACTTT
53 1328 0.00282596 TGTGCTCTCGTCCCTTCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV6*00(549.9) nan TRAJ4*00(290.2) TRAC*00(271) 426 434 459 0 8 40.0 nan 24 52 83 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTCGTCCCTTCTGGTGGCTACAATAAGCTGATTTTT
55 1305 0.00277702 TGTGCTCTGAGTGAGGCGGCGAACAGAGATGACAAGATCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(558.4) nan TRAJ30*00(271.8) TRAC*00(254) 432 450 469 0 18 90.0 nan 21 46 77 20 45 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGGCGAACAGAGATGACAAGATCATCTTT
56 1283 0.0027302 TGCATCGTCAGAGTACCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-1*00(603) nan TRAJ40*00(290.9) TRAC*00(279.2) 411 425 447 0 14 70.0 nan 22 50 81 13 41 140.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCGTCAGAGTACCTCAGGAACCTACAAATACATCTTT
57 1282 0.00272807 TGTGTGGTGAGCGCTTACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV10*00(548.1) nan TRAJ3*00(279.6) TRAC*00(237.6) 429 443 462 0 14 70.0 nan 24 51 82 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAGCGCTTACAGCAGTGCTTCCAAGATAATCTTT
59 1244 0.00264721 TGTGTGGTGAGCGCGAGATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV10*00(632.1) nan TRAJ42*00(294.8) TRAC*00(262.9) 429 444 462 0 15 75.0 nan 26 55 86 17 46 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAGCGCGAGATGGAGGAAGCCAAGGAAATCTCATCTTT
62 1220 0.00259614 TGTGCAGAGAGAGGTAACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(456.5) nan TRAJ20*00(260.2) TRAC*00(250.5) 426 437 459 0 11 55.0 nan 24 46 77 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGAGGTAACGACTACAAGCTCAGCTTT
65 1178 0.00250676 TGTGCAGGAGGGCAACTGACAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(492.4) nan TRAJ45*00(297.1) TRAC*00(264.7) 417 427 447 0 10 50.0 nan 26 55 86 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGGGCAACTGACAGGAGGAGGTGCTGACGGACTCACCTTT
67 1165 0.0024791 TGTGCTGTGAGGGGTAGCAACTATAAACTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(641.4) nan TRAJ53*00(256.9) TRAC*00(158.8) 423 435 455 0 12 60.0 nan 31 55 86 12 36 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGGGGTAGCAACTATAAACTGACATTT
70 1100 0.00234078 TGTGCAGCCTTACCCTTAATTCAGGGAGCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(482.1) nan TRAJ54*00(281.8) TRAC*00(291.5) 444 452 477 0 8 40.0 nan 20 49 80 16 45 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCCTTACCCTTAATTCAGGGAGCCCAGAAGCTGGTATTT
72 1096 0.00233227 TGTGCTGTTAATGTGCTGCATTGC NNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(519.7) nan TRAJ35*00(225.6) TRAC*00(295.8) 423 431 455 0 8 40.0 nan 33 48 79 9 24 75.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTAATGTGCTGCATTGC
74 1081 0.00230035 TGTGCTACGGCCTTAGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(515.1) nan TRAJ16*00(247.5) TRAC*00(266) 423 433 456 0 10 50.0 nan 27 49 80 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGCCTTAGATGGCCAGAAGCTGCTCTTT
75 1061 0.00225779 TGTGCTCTGAGTGAGGCGCAACGAAGCGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(446.9) nan TRAJ3*00(235.9) TRAC*00(271.2) 432 451 469 0 19 95.0 nan 33 51 82 27 45 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGCAACGAAGCGCTTCCAAGATAATCTTT
76 1059 0.00225353 TGTGCAGGAGAAACCAGTGGCTCTAGGTTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(499.2) nan TRAJ58*00(291.5) TRAC*00(268.5) 417 427 447 0 10 50.0 nan 24 52 83 8 36 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGAAACCAGTGGCTCTAGGTTGACCTTT
80 1048 0.00223012 TGTGGCACAGAGATCTACGACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV30*00(414.1) nan TRAJ20*00(251.5) TRAC*00(268.5) 423 439 456 0 16 SC425T 64.0 nan 26 46 77 19 39 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGGCACAGAGATCTACGACGACTACAAGCTCAGCTTT
81 1041 0.00221523 TGTGCAGGGCCCCGCGATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(486.1) nan TRAJ48*00(233.5) TRAC*00(167.2) 417 429 446 0 12 60.0 nan 35 52 83 16 33 85.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGCCCCGCGATGAGAAATTAACCTTT
82 1039 0.00221097 TGTGCCGTGAACGAGGAATATGGGAACAACAGACTCGCTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(672.3) nan TRAJ7*00(265.5) TRAC*00(147.2) 429 441 462 0 12 60.0 nan 24 48 79 18 42 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACGAGGAATATGGGAACAACAGACTCGCTTTT
87 989 0.00210457 TGTGGAGCGGTCGGTGGTACTAGCTATGGAAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV34*00(498.6) nan TRAJ52*00(297.3) TRAC*00(265.9) 423 431 456 0 8 40.0 nan 28 58 89 12 42 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGGAGCGGTCGGTGGTACTAGCTATGGAAAGCTGACATTT
88 985 0.00209606 TGTGCTCTGAGTGAGTCTTCAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(535) nan TRAJ11*00(269.3) TRAC*00(258.5) 432 447 469 0 15 75.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGTCTTCAGGATACAGCACCCTCACCTTT
89 982 0.00208968 TGTGCTGTGAGTGAGTAATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-2*00(591) nan TRAJ23*00(279) TRAC*00(277.3) 426 440 460 0 14 ST430C 54.0 nan 26 52 83 17 43 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGTGAGTAATAACCAGGGAGGAAAGCTTATCTTC
92 969 0.00206201 TGTGCAGCAATCCCTTTTATACTCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV23DV6*00(175.8) nan TRAJ10*00(322.3) TRAC*00(239.1) 450 460 483 0 10 50.0 nan 19 53 84 17 51 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAATCCCTTTTATACTCACGGGAGGAGGAAACAAACTCACCTTT
95 958 0.00203861 TGTGCTACGGACGGGATGGGTGGTACTAGCTATGGAAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(527.5) nan TRAJ52*00(292.8) TRAC*00(236.6) 423 436 456 0 13 65.0 nan 28 58 89 18 48 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGGGATGGGTGGTACTAGCTATGGAAAGCTGACATTT
96 957 0.00203648 TGTGCAGCAAGCGTGTGGTTTCAGGGAGCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(550.8) nan TRAJ54*00(273.8) TRAC*00(266.3) 444 457 477 0 13 65.0 nan 23 49 80 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGTGTGGTTTCAGGGAGCCCAGAAGCTGGTATTT
97 955 0.00203222 TGTGCAGGGAATGCTGGTGGTACTAGCTATGGAAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(483.1) nan TRAJ52*00(324.7) TRAC*00(252.2) 417 426 446 0 9 45.0 nan 22 58 89 9 45 180.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGAATGCTGGTGGTACTAGCTATGGAAAGCTGACATTT
101 943 0.00200669 TGTGCTACGGATCCTTCAGGAAACACACCTCTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(605.6) nan TRAJ29*00(276.6) TRAC*00(238.6) 423 434 456 0 11 55.0 nan 24 49 80 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGATCCTTCAGGAAACACACCTCTTGTCTTT
106 914 0.00194497 TGTGCTACGGCCTACCCCGGGGGCGGATCTGAAAAGCTGGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(519.3) nan TRAJ57*00(271.8) TRAC*00(259.8) 423 433 456 0 10 50.0 nan 27 52 83 20 45 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGCCTACCCCGGGGGCGGATCTGAAAAGCTGGTCTTT
108 913 0.00194285 TGTGCTGGGGGCACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(464.8) nan TRAJ49*00(259.6) TRAC*00(265.8) 426 433 462 0 7 35.0 nan 23 45 76 11 33 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGGGGGCACCGGTAACCAGTTCTATTTT
110 904 0.00192369 TGTGCAATGAGAGAGGGCGGGAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(599.9) nan TRAJ48*00(287.3) TRAC*00(244.6) 432 450 469 0 18 90.0 nan 25 52 83 21 48 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGGCGGGAACTTTGGAAATGAGAAATTAACCTTT
111 900 0.00191518 TGTGCTGTGGAAGGCAACACAGGCAAACTAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(588.5) nan TRAJ37*00(269.8) TRAC*00(283) 423 434 457 0 11 55.0 nan 27 51 82 12 36 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAAGGCAACACAGGCAAACTAATCTTT
114 894 0.00190242 TGTGTCTACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(605) nan TRAJ3*00(282.2) TRAC*00(227.6) 426 430 459 0 4 20.0 nan 24 51 82 6 33 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTCTACAGCAGTGCTTCCAAGATAATCTTT
115 886 0.00188539 TGTGCCGCTTTTCTTTCTGGTTCTGCAAGGCAACTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(495.1) nan TRAJ22*00(289.8) TRAC*00(255) 429 436 462 0 7 35.0 nan 24 52 83 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGCTTTTCTTTCTGGTTCTGCAAGGCAACTGACCTTT
119 876 0.00186411 TGTGCTACGGGAGCGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(524.7) nan TRAJ10*00(281.8) TRAC*00(283.5) 423 433 456 0 10 50.0 nan 27 53 84 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGGAGCGGGAGGAGGAAACAAACTCACCTTT
122 870 0.00185134 TGTGCAATGAGAGACGACACGGGCAGGAGAGCACTTACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(521) nan TRAJ5*00(286.2) TRAC*00(223.6) 432 446 469 0 14 70.0 nan 22 49 80 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGACGACACGGGCAGGAGAGCACTTACTTTT
123 864 0.00183858 TGTGCAGGGGGGATGAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(536.4) nan TRAJ3*00(268.7) TRAC*00(247.5) 417 425 447 0 8 40.0 nan 27 51 82 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGGGGATGAGCAGTGCTTCCAAGATAATCTTT
126 854 0.0018173 TGTGCTACGGCCACATATGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(438.1) nan TRAJ32*00(300.1) TRAC*00(248.7) 423 433 456 0 10 50.0 nan 25 55 86 15 45 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGCCACATATGGTGGTGCTACAAACAAGCTCATCTTT
131 843 0.00179389 TGTGCAGAGAATATCACGTAACTAACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(374.1) nan TRAJ20*00(260.2) TRAC*00(260.8) 426 440 459 0 14 70.0 nan 23 46 77 21 44 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAATATCACGTAACTAACGACTACAAGCTCAGCTTT
135 822 0.0017492 TGTGCCGTGAGTGGACTCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(464.5) nan TRAJ10*00(303.6) TRAC*00(300.5) 429 439 462 0 10 50.0 nan 22 53 84 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAGTGGACTCACGGGAGGAGGAAACAAACTCACCTTT
136 818 0.00174069 TGTGCCGTGACCAGAGGCTCAACCCTGGGGAGGCTATACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(521.8) nan TRAJ18*00(298.2) TRAC*00(246) 429 439 462 0 10 50.0 nan 24 55 86 11 42 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGACCAGAGGCTCAACCCTGGGGAGGCTATACTTT
138 811 0.00172579 TGTGCAATGAGAGAGGGCGGCAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(538.1) nan TRAJ21*00(257.9) TRAC*00(263) 432 450 469 0 18 90.0 nan 22 44 75 20 42 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGGCGGCAACTTCAACAAATTTTACTTT
139 807 0.00171728 TGTGCTCTGAGTGAGGCGCAAGAGGGAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(542.9) nan TRAJ45*00(283) TRAC*00(236.3) 432 451 469 0 19 95.0 nan 27 55 86 26 54 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGCAAGAGGGAGGAGGAGGTGCTGACGGACTCACCTTT
141 806 0.00171515 TGTGCAGGTGGCCCAAATTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(499.1) nan TRAJ41*00(275.5) TRAC*00(275.9) 417 425 446 0 8 40.0 nan 25 51 82 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGTGGCCCAAATTCCGGGTATGCACTCAACTTC
143 803 0.00170877 TGTGCAATGAGAGAATGGGACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(579.5) nan TRAJ48*00(281.1) TRAC*00(247) 432 446 469 0 14 70.0 nan 26 52 83 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAATGGGACTTTGGAAATGAGAAATTAACCTTT
145 797 0.001696 TGTGTGGTCACTTCAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(498.4) nan TRAJ11*00(275.6) TRAC*00(243.3) 423 431 456 0 8 40.0 nan 24 49 80 11 36 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTCACTTCAGGATACAGCACCCTCACCTTT
147 793 0.00168749 TGTGCTGTGAGAGACATAGAAACTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(457.3) nan TRAJ4*00(260.9) TRAC*00(227.2) 426 443 462 0 17 85.0 nan 26 52 83 22 48 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACATAGAAACTGGTGGCTACAATAAGCTGATTTTT
149 782 0.00166408 TGTGCAGGGCTACCCATTTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(508.3) nan TRAJ48*00(271.9) TRAC*00(251.4) 417 427 446 0 10 50.0 nan 28 52 83 18 42 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGCTACCCATTTTTGGAAATGAGAAATTAACCTTT
150 782 0.00166408 TGTGCAGAGAACTCCCGGGGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(535.5) nan TRAJ4*00(268) TRAC*00(258.5) 426 436 459 0 10 50.0 nan 28 52 83 19 43 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAACTCCCGGGGGTGGCTACAATAAGCTGATTTTT
152 778 0.00165557 TGTGCTACGGACGGGAGGATCACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(579.5) nan TRAJ27*00(272.2) TRAC*00(216.4) 423 436 456 0 13 65.0 nan 23 48 79 20 45 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGGGAGGATCACCAATGCAGGCAAATCAACCTTT
153 777 0.00165344 TGTGCTTTCGCGATCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-1*00(654.7) nan TRAJ40*00(277.5) TRAC*00(246.5) 432 441 469 0 9 45.0 nan 25 50 81 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTTCGCGATCTCAGGAACCTACAAATACATCTTT
155 774 0.00164706 TGTGCTACGGACGCTTTTAACCCGAGCCCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(466.5) nan TRAJ54*00(225.3) TRAC*00(285.6) 423 437 456 0 14 70.0 nan 32 49 80 28 45 85.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGCTTTTAACCCGAGCCCCCAGAAGCTGGTATTT
156 761 0.00161939 TGTGCAGGGCTAGATAATGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(470.9) nan TRAJ39*00(268.4) TRAC*00(268.3) 417 427 446 0 10 50.0 nan 26 52 83 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGCTAGATAATGCAGGCAACATGCTCACCTTT
157 760 0.00161727 TGTGGAGCAGACGGGGGACCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV34*00(442.6) nan TRAJ45*00(278.6) TRAC*00(260.7) 423 435 456 0 12 60.0 nan 26 55 86 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGGAGCAGACGGGGGACCAGGAGGAGGTGCTGACGGACTCACCTTT
158 759 0.00161514 TGTGCCGTGTCTAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(696.8) nan TRAJ33*00(262.8) TRAC*00(129.5) 429 438 462 0 9 45.0 nan 24 46 77 11 33 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGTCTAGCAACTATCAGTTAATCTGG
159 758 0.00161301 TGTGCTACGGACGCGCTATACTCTGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(527.8) nan TRAJ28*00(317.2) TRAC*00(262.9) 423 438 456 0 15 75.0 nan 21 55 86 17 51 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGCGCTATACTCTGGGGCTGGGAGTTACCAACTCACTTTC
160 756 0.00160875 TGTGATGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(553.6) nan TRAJ6*00(261.4) TRAC*00(248.7) 423 427 456 0 4 20.0 nan 27 51 82 6 30 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGATGGAGGAAGCTACATACCTACATTT
161 751 0.00159811 TGTGCTGTCAGGAGGGGTTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(539.7) nan TRAJ42*00(303.6) TRAC*00(244) 423 434 455 0 11 55.0 nan 24 55 86 17 48 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTCAGGAGGGGTTATGGAGGAAGCCAAGGAAATCTCATCTTT
163 750 0.00159599 TGTGCTCCATGAGCAGCGCATTCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(517.4) nan TRAJ4*00(287.6) TRAC*00(237.8) 432 439 469 0 7 35.0 nan 24 52 83 20 48 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCCATGAGCAGCGCATTCTGGTGGCTACAATAAGCTGATTTTT
166 745 0.00158535 TGTGCTTTCATGACTCCCCGGGCCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-1*00(428.1) nan TRAJ49*00(246.6) TRAC*00(220.8) 432 445 469 0 13 65.0 nan 25 45 76 22 42 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTTCATGACTCCCCGGGCCGGTAACCAGTTCTATTTT
167 744 0.00158322 TGTGCAATGACCTTAAATACTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(528) nan TRAJ9*00(288.3) TRAC*00(257.6) 429 439 462 0 10 50.0 nan 22 50 81 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGACCTTAAATACTGGAGGCTTCAAAACTATCTTT
170 734 0.00156194 TGTGCTGTGCGGAGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV1-2*00(569.3) nan TRAJ4*00(249.9) TRAC*00(246.5) 411 420 445 0 9 45.0 nan 32 52 83 13 33 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGCGGAGCTACAATAAGCTGATTTTT
171 731 0.00155555 TGTGCTCTGAGTGAGGCGGGGGATTCAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(615.2) nan TRAJ11*00(277.6) TRAC*00(237.3) 432 450 469 0 18 90.0 nan 23 49 80 22 48 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGGGGGATTCAGGATACAGCACCCTCACCTTT
172 730 0.00155343 TGTGCCCCCGAGTGGGGCCCCTCTGACAGCTGGGGGAAATTCCAGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(532.6) nan TRAJ24*00(262) TRAC*00(248.9) 423 428 457 0 5 25.0 nan 26 52 83 22 48 SG45C 114.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCCCCGAGTGGGGCCCCTCTGACAGCTGGGGGAAATTCCAGTTT
173 729 0.0015513 TGTGCTGCCCAGGCGGATTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(462.5) nan TRAJ42*00(297) TRAC*00(249.6) 423 430 455 0 7 35.0 nan 23 55 86 16 48 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGCCCAGGCGGATTATGGAGGAAGCCAAGGAAATCTCATCTTT
174 728 0.00154917 TGTGCTGTCAGATATAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(515.7) nan TRAJ26*00(280.3) TRAC*00(222.3) 423 436 455 0 13 65.0 nan 23 49 80 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTCAGATATAACTATGGTCAGAATTTTGTCTTT
176 727 0.00154704 TGTGCAATGAGCGATCCTAACAATGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(492.9) nan TRAJ31*00(252.3) TRAC*00(239.5) 429 442 462 0 13 65.0 nan 24 46 77 17 39 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGATCCTAACAATGCCAGACTCATGTTT
179 721 0.00153427 TGTGCCGTGATGTACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(393.1) nan TRAJ3*00(282.4) TRAC*00(240.9) 429 439 462 0 10 50.0 nan 23 51 82 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGATGTACAGCAGTGCTTCCAAGATAATCTTT
183 709 0.00150874 TGTGCTCTAAAGGACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV16*00(524.8) nan TRAJ34*00(246.6) TRAC*00(287.6) 414 424 448 0 10 50.0 nan 27 47 78 13 33 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAAAGGACACCGACAAGCTCATCTTT
185 698 0.00148533 TGTGCAGCAAGGGGTTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(585.2) nan TRAJ41*00(260) TRAC*00(253.7) 423 434 456 0 11 55.0 nan 29 51 82 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGGGGTTCCGGGTATGCACTCAACTTC
189 683 0.00145341 TGTGCAGGAGTAGGGTTTTCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(487.9) nan TRAJ4*00(306.1) TRAC*00(294.8) 417 427 447 0 10 50.0 nan 21 52 83 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGTAGGGTTTTCTGGTGGCTACAATAAGCTGATTTTT
190 680 0.00144703 TGTGCCGTGAATGGAGGGATCAATGACATGCGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-1*00(522.7) nan TRAJ43*00(232.8) TRAC*00(258.8) 426 439 460 0 13 65.0 nan 27 43 74 20 36 80.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAATGGAGGGATCAATGACATGCGCTTT
191 676 0.00143852 TGTGCAATGAGAGAAGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(506.2) nan TRAJ33*00(263.6) TRAC*00(240.7) 432 446 469 0 14 70.0 nan 22 46 77 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAAGATAGCAACTATCAGTTAATCTGG
192 674 0.00143426 TGTGCCGTCCTCGAAACATTT NNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(630.6) nan TRAJ6*00(175.6) TRAC*00(224.3) 429 437 462 0 8 40.0 nan 45 51 82 15 21 30.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTCCTCGAAACATTT
194 671 0.00142788 TGTGCGGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(526.3) nan TRAJ16*00(247.6) TRAC*00(250.1) 423 428 456 0 5 25.0 nan 28 49 80 6 27 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCGGATGGCCAGAAGCTGCTCTTT
195 665 0.00141511 TGTGCAGCAAGCGAAGGGCCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(668.3) nan TRAJ45*00(297.1) TRAC*00(129.3) 444 457 477 0 13 65.0 nan 26 55 86 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGAAGGGCCAGGAGGAGGTGCTGACGGACTCACCTTT
198 661 0.0014066 TGTGCTCTCTTGAACAATGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(501.8) nan TRAJ31*00(243.9) TRAC*00(251.2) 423 429 455 0 6 30.0 nan 25 46 77 12 33 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTCTTGAACAATGCCAGACTCATGTTT
199 661 0.0014066 TGCATCCTGAGACCCTGGTGGTACTAGCTATGGAAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-2*00(464.8) nan TRAJ52*00(303.5) TRAC*00(269.6) 411 423 446 0 12 60.0 nan 26 58 89 14 46 160.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCCTGAGACCCTGGTGGTACTAGCTATGGAAAGCTGACATTT
200 650 0.00138319 TGTGCTCTAAAGGACCAAACCAGTGGCTCTAGGTTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV16*00(620.9) nan TRAJ58*00(279.4) TRAC*00(220.9) 414 424 448 0 10 50.0 nan 26 52 83 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAAAGGACCAAACCAGTGGCTCTAGGTTGACCTTT
203 649 0.00138106 TGCCTCGTGGAGACTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV4*00(560.4) nan TRAJ9*00(272.6) TRAC*00(253.3) 411 421 447 0 10 50.0 nan 26 50 81 12 36 120.0 nan nan nan nan nan nan nan nan nan nan nan TGCCTCGTGGAGACTGGAGGCTTCAAAACTATCTTT
204 645 0.00137255 TGTGCAATGAGGGTAACTCAGGGCGGATCTGAAAAGCTGGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(473) nan TRAJ57*00(306.2) TRAC*00(244.1) 432 443 469 0 11 55.0 nan 20 52 83 13 45 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGGGTAACTCAGGGCGGATCTGAAAAGCTGGTCTTT
208 627 0.00133424 TGTGCTACGGACGATGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(601.7) nan TRAJ4*00(269.8) TRAC*00(122.6) 423 436 456 0 13 65.0 nan 27 52 83 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGATGGTGGCTACAATAAGCTGATTTTT
209 620 0.00131935 CCCAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(460) nan TRAJ48*00(286.4) TRAC*00(264.7) 417 417 447 0 0 0.0 nan 25 52 83 3 30 135.0 nan nan nan nan nan nan nan nan nan nan nan CCCAACTTTGGAAATGAGAAATTAACCTTT
210 619 0.00131722 TGTGCTCTGAACCTCTATAATACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(633.6) nan TRAJ34*00(253.1) TRAC*00(228.6) 432 442 469 0 10 50.0 nan 23 47 78 15 39 SC28T 104.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAACCTCTATAATACCGACAAGCTCATCTTT
211 616 0.00131084 TGTGTGTCCTCAGGAGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(387.3) nan TRAJ12*00(253.4) TRAC*00(266.9) 423 429 456 0 6 30.0 nan 25 49 80 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGTCCTCAGGAGATAGCAGCTATAAATTGATCTTC
212 616 0.00131084 TGTGCTGTCGAAGGAGGTAGCAACTATAAACTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(431.3) nan TRAJ53*00(275.8) TRAC*00(306) 423 432 455 0 9 45.0 nan 28 55 86 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTCGAAGGAGGTAGCAACTATAAACTGACATTT
213 612 0.00130232 TGTGCAGCAAGTAGAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(556.1) nan TRAJ11*00(252.2) TRAC*00(253.4) 423 436 456 0 13 65.0 nan 27 49 80 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTAGAGGATACAGCACCCTCACCTTT
214 611 0.0013002 TGTGCCGTGAGAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(531.9) nan TRAJ11*00(258.3) TRAC*00(263.6) 429 439 462 0 10 50.0 nan 27 49 80 11 33 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAGAGGATACAGCACCCTCACCTTT
216 608 0.00129381 TGTGCTGTTCCTGTTCCGTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(471.6) nan TRAJ48*00(255.9) TRAC*00(294.5) 423 431 455 0 8 40.0 nan 28 52 83 18 42 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTCCTGTTCCGTTTGGAAATGAGAAATTAACCTTT
218 605 0.00128743 TGTGCTCTGAGTGAGGCGGGGAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(588.8) nan TRAJ23*00(263.7) TRAC*00(246.4) 432 450 469 0 18 90.0 nan 28 52 83 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGGGGAACCAGGGAGGAAAGCTTATCTTC
221 595 0.00126615 TGTGCAGGAGGTCCGAGGGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(451.8) nan TRAJ48*00(241.8) TRAC*00(291.1) 417 431 447 0 14 SC427G 54.0 nan 31 52 83 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGGTCCGAGGGGAAATGAGAAATTAACCTTT
224 588 0.00125125 TGTGCAGCAAGCTTCTAATTCTGGGGGTTACCAGAAAGTTACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV23DV6*00(595.4) nan TRAJ13*00(299.1) TRAC*00(244.7) 450 462 483 0 12 60.0 nan 22 52 83 16 46 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCTTCTAATTCTGGGGGTTACCAGAAAGTTACCTTT
225 588 0.00125125 TGTGATTCATCTGGTTCTGCAAGGCAACTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(538.6) nan TRAJ22*00(290.3) TRAC*00(176.3) 423 427 456 0 4 20.0 nan 21 52 83 5 36 ST24A 139.0 nan nan nan nan nan nan nan nan nan nan nan TGTGATTCATCTGGTTCTGCAAGGCAACTGACCTTT
226 582 0.00123848 TGTGCATCCACAGGAGGAGGCCGGGGCACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(472) nan TRAJ34*00(236.9) TRAC*00(258.7) 429 435 462 0 6 30.0 nan 28 47 78 26 45 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCATCCACAGGAGGAGGCCGGGGCACCGACAAGCTCATCTTT
227 574 0.00122146 TGTGCTCTGATCAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV9-2*00(523.1) nan TRAJ48*00(266) TRAC*00(218.3) 423 433 457 0 10 50.0 nan 25 52 83 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGATCAACTTTGGAAATGAGAAATTAACCTTT
229 570 0.00121295 TGTGCCTTTCCCACGATTTATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(495.9) nan TRAJ23*00(305.9) TRAC*00(233.9) 432 441 462 0 9 45.0 nan 21 52 83 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTTTCCCACGATTTATAACCAGGGAGGAAAGCTTATCTTC
230 569 0.00121082 TGTGCTACGGAAACCGGCACTGCCAGTAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(464.9) nan TRAJ44*00(288.6) TRAC*00(240.9) 423 434 456 0 11 55.0 nan 25 52 83 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGAAACCGGCACTGCCAGTAAACTCACCTTT
231 568 0.00120869 TGTGCTTTCATGACCCCCTCAAATTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-1*00(577.6) nan TRAJ41*00(287.3) TRAC*00(243.5) 432 445 469 0 13 65.0 nan 23 51 82 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTTCATGACCCCCTCAAATTCCGGGTATGCACTCAACTTC
234 563 0.00119805 TGTGCCTTCATGATTTATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(473.3) nan TRAJ23*00(328.6) TRAC*00(293.6) 432 440 462 0 8 40.0 nan 17 52 83 7 42 175.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTTCATGATTTATAACCAGGGAGGAAAGCTTATCTTC
236 559 0.00118954 TGTGCCGAGGAGCTTGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV39*00(468.2) nan TRAJ28*00(288.3) TRAC*00(299.6) 417 428 450 0 11 ST424A 39.0 nan 27 55 86 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGAGGAGCTTGGGGCTGGGAGTTACCAACTCACTTTC
239 550 0.00117039 TGTGCTCTGAGTGAGGGCGGAAATACTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(554.1) nan TRAJ9*00(295.1) TRAC*00(190.8) 432 448 469 0 16 80.0 nan 19 50 81 17 48 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGGCGGAAATACTGGAGGCTTCAAAACTATCTTT
241 549 0.00116826 TGTGCTGTGTGTCCGTCATACAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV22*00(537.4) nan TRAJ21*00(271.3) TRAC*00(264.1) 417 426 450 0 9 45.0 nan 19 44 75 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGTGTCCGTCATACAACTTCAACAAATTTTACTTT
244 545 0.00115975 TGTGCTCTAGACCCCCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV6*00(482.9) nan TRAJ15*00(261.3) TRAC*00(263.2) 426 438 459 0 12 60.0 nan 24 49 80 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAGACCCCCAGGCAGGAACTGCTCTGATCTTT
245 544 0.00115762 TGTGCAGGAGAGGTTGCCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(505.3) nan TRAJ40*00(279.9) TRAC*00(242.3) 417 427 447 0 10 50.0 nan 24 50 81 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGAGGTTGCCTCAGGAACCTACAAATACATCTTT
246 543 0.00115549 TGTGCTGTGAGTGGCCCAGAAAGCTGCAGGCAACAAGCTAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-4*00(403.7) nan TRAJ17*00(287.7) TRAC*00(284.6) 426 439 460 0 13 65.0 nan 25 52 83 19 46 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGTGGCCCAGAAAGCTGCAGGCAACAAGCTAACTTTT
249 539 0.00114698 TGTGCTACTACTGGGGGTTACCAGAAAGTTACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(506.3) nan TRAJ13*00(268.8) TRAC*00(256.5) 423 431 456 0 8 40.0 nan 26 52 83 10 36 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACTACTGGGGGTTACCAGAAAGTTACCTTT
252 535 0.00113847 TGTGTGGTTCCCGTTCGCGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(560.6) nan TRAJ16*00(249.2) TRAC*00(290.8) 423 431 456 0 8 40.0 nan 28 49 80 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTTCCCGTTCGCGATGGCCAGAAGCTGCTCTTT
253 535 0.00113847 TGTGCAGCAAGCGACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(552.5) nan TRAJ26*00(259.7) TRAC*00(303.1) 444 457 477 0 13 65.0 nan 26 49 80 13 36 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGACTATGGTCAGAATTTTGTCTTT
255 533 0.00113421 TGTGCAGTGCCCCGTGGGAGAGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(459) nan TRAJ39*00(256.5) TRAC*00(271) 426 433 459 0 7 35.0 nan 31 52 83 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGTGCCCCGTGGGAGAGCAGGCAACATGCTCACCTTT
256 528 0.00112357 TGTGTGGTGAACTCTGGGTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(611.5) nan TRAJ20*00(223.8) TRAC*00(287.8) 423 435 456 0 12 60.0 nan 31 46 77 18 33 75.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAACTCTGGGTACAAGCTCAGCTTT
257 526 0.00111932 TGTGCAATGAGCGCGAGAGGCTTTGGGAATGTGCTGCATTGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(439.9) nan TRAJ35*00(279.8) TRAC*00(283.7) 429 444 462 0 15 75.0 nan 19 48 79 13 42 ST22G 129.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGCGAGAGGCTTTGGGAATGTGCTGCATTGC
260 516 0.00109804 TGTGCTACGGACGCTGATGCGAATTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(468.5) nan TRAJ41*00(267.5) TRAC*00(276.9) 423 437 456 0 14 70.0 nan 27 51 82 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGCTGATGCGAATTCCGGGTATGCACTCAACTTC
261 515 0.00109591 TGTGCAGAGAGATAGGTAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(489.1) nan TRAJ23*00(276) TRAC*00(271.9) 426 437 459 0 11 55.0 nan 27 52 83 16 41 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGATAGGTAACCAGGGAGGAAAGCTTATCTTC
262 513 0.00109165 TGTGCTGGGTACAATAACAATGACATGCGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV35*00(517) nan TRAJ43*00(277.2) TRAC*00(223) 417 426 449 0 9 45.0 nan 18 43 74 8 33 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGGGTACAATAACAATGACATGCGCTTT
263 511 0.0010874 TGTGCCGTTAACTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(532.5) nan TRAJ40*00(272) TRAC*00(246) 429 441 462 0 12 SG437T 44.0 nan 25 50 81 11 36 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTTAACTCAGGAACCTACAAATACATCTTT
266 496 0.00105548 TGTGCTGTGCAGGCAAAGACTGGTAGGGACAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(624.9) nan TRAJ21*00(261.6) TRAC*00(198.8) 423 437 456 0 14 70.0 nan 21 44 75 28 51 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGCAGGCAAAGACTGGTAGGGACAACTTCAACAAATTTTACTTT
267 495 0.00105335 TGTGCAATGAGCTCTAACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(467) nan TRAJ20*00(270.9) TRAC*00(219.5) 429 441 462 0 12 60.0 nan 22 46 77 12 36 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCTCTAACGACTACAAGCTCAGCTTT
268 494 0.00105122 TGTGCAGGGGTTTTTTCTAACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(526.3) nan TRAJ20*00(270.1) TRAC*00(246.1) 417 426 446 0 9 45.0 nan 21 46 77 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGGTTTTTTCTAACGACTACAAGCTCAGCTTT
269 493 0.00104909 TGTGCTGCCCCTGAACACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(549.1) nan TRAJ49*00(270.4) TRAC*00(268.3) 423 430 455 0 7 35.0 nan 20 45 76 12 37 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGCCCCTGAACACCGGTAACCAGTTCTATTTT
270 489 0.00104058 TGTGCAGGGGCTTATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(537.3) nan TRAJ23*00(278.3) TRAC*00(216.3) 417 429 447 0 12 SA425G 44.0 nan 24 52 83 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGGCTTATAACCAGGGAGGAAAGCTTATCTTC
271 488 0.00103845 TGTGCTGTGAGGACCCTATCAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(502.6) nan TRAJ6*00(284.3) TRAC*00(229.9) 423 435 455 0 12 60.0 nan 23 51 82 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGGACCCTATCAGGAGGAAGCTACATACCTACATTT
277 474 0.00100866 TGTGCTCTTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV6*00(575.5) nan TRAJ4*00(270.9) TRAC*00(255.9) 426 434 459 0 8 40.0 nan 27 52 83 8 33 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTTGGTGGCTACAATAAGCTGATTTTT
279 465 0.000989511 TGTGTGGTGTTCCCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(491.1) nan TRAJ4*00(279.4) TRAC*00(258.3) 423 432 456 0 9 45.0 nan 26 52 83 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGTTCCCTGGTGGCTACAATAAGCTGATTTTT
280 464 0.000987383 TGTGCAGAGGATAACAATGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(493.5) nan TRAJ31*00(262.9) TRAC*00(272.9) 426 435 459 0 9 45.0 nan 23 46 77 10 33 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGGATAACAATGCCAGACTCATGTTT
281 464 0.000987383 TGTGCAATGAGAGAGCCCGCATACTCTGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(456.6) nan TRAJ28*00(322) TRAC*00(247.3) 432 447 469 0 15 75.0 nan 19 55 86 18 54 180.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGCCCGCATACTCTGGGGCTGGGAGTTACCAACTCACTTTC
282 462 0.000983127 TGTGCTCTGAGTCGGGGATCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(463.7) nan TRAJ10*00(288.3) TRAC*00(267.7) 432 444 469 0 12 60.0 nan 24 53 84 18 47 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTCGGGGATCACGGGAGGAGGAAACAAACTCACCTTT
284 453 0.000963975 TGTGCTGTGGGCTCCGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV22*00(528) nan TRAJ28*00(288.9) TRAC*00(272.8) 417 427 450 0 10 50.0 nan 24 55 86 11 42 ST27C 139.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGGCTCCGGGGCTGGGAGTTACCAACTCACTTTC
285 453 0.000963975 TGTGCTACGTACTACTCTGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(523.3) nan TRAJ28*00(309.4) TRAC*00(245.8) 423 432 456 0 9 45.0 nan 22 55 86 12 45 165.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGTACTACTCTGGGGCTGGGAGTTACCAACTCACTTTC
289 449 0.000955463 TGTGTGGTGAGCCAGTGGGGAAAGCTTTGGGAATGTGCTGCATTGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV10*00(588.4) nan TRAJ35*00(262.8) TRAC*00(223.5) 429 441 462 0 12 60.0 nan 25 48 79 23 46 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAGCCAGTGGGGAAAGCTTTGGGAATGTGCTGCATTGC
291 446 0.00094908 TGTGCTGTGAGGGACTTGAATTCAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(480.6) nan TRAJ11*00(287.2) TRAC*00(245) 423 435 455 0 12 60.0 nan 20 49 80 16 45 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGGGACTTGAATTCAGGATACAGCACCCTCACCTTT
293 440 0.000936312 TGTGCAACTTATACTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(526.7) nan TRAJ9*00(282) TRAC*00(245.5) 429 436 462 0 7 35.0 nan 24 50 81 10 36 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAACTTATACTGGAGGCTTCAAAACTATCTTT
296 435 0.000925672 TGTGCAATGTCCGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(427) nan TRAJ11*00(257.2) TRAC*00(244.1) 429 438 462 0 9 45.0 nan 28 49 80 12 33 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGTCCGGATACAGCACCCTCACCTTT
298 431 0.00091716 TGTGCTAAGTCAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(479.9) nan TRAJ6*00(279.1) TRAC*00(293.9) 423 429 457 0 6 30.0 nan 24 51 82 9 36 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTAAGTCAGGAGGAAGCTACATACCTACATTT
301 429 0.000912904 TGTGCAGCAAGATCGTATCAGGGAGCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(486.3) nan TRAJ54*00(268) TRAC*00(240.9) 423 434 456 0 11 55.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGATCGTATCAGGGAGCCCAGAAGCTGGTATTT
303 425 0.000904392 TGTGCAGCAAGCGCGACTGGAGCCAATAGTAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(447) nan TRAJ56*00(275.1) TRAC*00(239.2) 444 459 477 0 15 75.0 nan 24 51 82 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGCGACTGGAGCCAATAGTAAGCTGACATTT
304 422 0.000898008 TGTGCAGCAAAGCTAAGTGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(543.4) nan TRAJ11*00(258.5) TRAC*00(267.8) 423 433 456 0 10 50.0 nan 28 49 80 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAAGCTAAGTGGATACAGCACCCTCACCTTT
306 421 0.00089588 TGTGCCGTGAACCCGTACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(476.1) nan TRAJ3*00(284.4) TRAC*00(286.1) 429 441 462 0 12 60.0 nan 23 51 82 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACCCGTACAGCAGTGCTTCCAAGATAATCTTT
308 420 0.000893752 TGTGCAGAGGGCGGTGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(490.5) nan TRAJ39*00(251.3) TRAC*00(282.4) 426 435 459 0 9 45.0 nan 30 52 83 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGGGCGGTGCAGGCAACATGCTCACCTTT
311 418 0.000889496 TGTGCTGCCTCAGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(566.1) nan TRAJ11*00(264.1) TRAC*00(230.4) 423 430 455 0 7 35.0 nan 25 49 80 9 33 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGCCTCAGGATACAGCACCCTCACCTTT
312 413 0.000878856 TGTGCAATGAGGGCGACAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(562.4) nan TRAJ6*00(280.2) TRAC*00(247.4) 429 444 462 0 15 SC440G 59.0 nan 25 51 82 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGGGCGACAGGAGGAAGCTACATACCTACATTT
313 412 0.000876728 TGTGCCGTGGTAGGGGAAACCAGTGGCTCTAGGTTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV39*00(424.9) nan TRAJ58*00(270.5) TRAC*00(300.5) 417 427 450 0 10 50.0 nan 25 52 83 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGGTAGGGGAAACCAGTGGCTCTAGGTTGACCTTT
314 411 0.0008746 TGTGCCGTGAACAACTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(451.5) nan TRAJ42*00(300.2) TRAC*00(266.6) 429 442 462 0 13 65.0 nan 25 55 86 15 45 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACAACTATGGAGGAAGCCAAGGAAATCTCATCTTT
315 405 0.000861832 TGTGCTCTGAGTGAGATCATGGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(655.4) nan TRAJ33*00(290.3) TRAC*00(114.5) 432 447 469 0 15 75.0 nan 18 46 77 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGATCATGGATAGCAACTATCAGTTAATCTGG
317 398 0.000846936 TGTGTGGTGAACATTGGGTTATACTCTGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(564.8) nan TRAJ28*00(319.3) TRAC*00(234.8) 423 437 456 0 14 70.0 nan 21 55 86 20 54 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAACATTGGGTTATACTCTGGGGCTGGGAGTTACCAACTCACTTTC
318 395 0.000840553 TGTGCTGTGGAGGATGAACCGGGAGCTGCAGGCAACAAGCTAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(188.7) nan TRAJ17*00(274.4) TRAC*00(239.3) 423 438 457 0 15 75.0 nan 27 52 83 23 48 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAGGATGAACCGGGAGCTGCAGGCAACAAGCTAACTTTT
320 393 0.000836297 TGTGCAGAGAGAGAGGGAAACACAGGCAAACTAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(503.7) nan TRAJ37*00(249) TRAC*00(222.9) 426 437 459 0 11 55.0 nan 30 51 82 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGAGAGGGAAACACAGGCAAACTAATCTTT
322 389 0.000827785 TGTGCAATGAGAGAGGGCAGTGGAAACAAACTGGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(565.3) nan TRAJ47*00(246.2) TRAC*00(266.2) 432 450 469 0 18 90.0 nan 27 46 77 20 39 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGGCAGTGGAAACAAACTGGTCTTT
324 384 0.000817145 TGTGCTACGGATGCAGATTCTACCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(399.1) nan TRAJ40*00(271.7) TRAC*00(280.9) 423 434 456 0 11 55.0 nan 21 50 81 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGATGCAGATTCTACCTCAGGAACCTACAAATACATCTTT
325 382 0.000812889 TGTGCTGTCAAAGCTGCAGGCAACAAGCTAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(478.4) nan TRAJ17*00(278.4) TRAC*00(232.2) 423 431 456 0 8 40.0 nan 23 52 83 7 36 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTCAAAGCTGCAGGCAACAAGCTAACTTTT
327 379 0.000806505 TGTGCAGCAAGTATTACGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(573.6) nan TRAJ12*00(272.5) TRAC*00(247.9) 423 437 456 0 14 70.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTATTACGGATAGCAGCTATAAATTGATCTTC
329 375 0.000797993 TGTGCTGTCGCCCCCGATTCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(438.9) nan TRAJ45*00(302.4) TRAC*00(262.8) 423 431 455 0 8 40.0 nan 23 55 86 16 48 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTCGCCCCCGATTCAGGAGGAGGTGCTGACGGACTCACCTTT
330 375 0.000797993 TGTGCCGTGAACCTTGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(515.1) nan TRAJ6*00(268) TRAC*00(245) 429 441 462 0 12 60.0 nan 27 51 82 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACCTTGGAGGAAGCTACATACCTACATTT
333 369 0.000785225 TGTGTGGTGACTGGGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(618.2) nan TRAJ12*00(273.2) TRAC*00(243.2) 423 433 456 0 10 50.0 nan 24 49 80 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGACTGGGGATAGCAGCTATAAATTGATCTTC
334 369 0.000785225 TGTGCTGTGAGAGGAGGTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV1-2*00(359.8) nan TRAJ9*00(262.8) TRAC*00(244) 411 424 445 0 13 65.0 nan 28 50 81 17 39 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGGAGGTGGAGGCTTCAAAACTATCTTT
338 363 0.000772457 TGTGCAGGGGGCGTAGACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(416.9) nan TRAJ48*00(270.2) TRAC*00(243) 417 426 446 0 9 45.0 nan 26 52 83 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGGGCGTAGACTTTGGAAATGAGAAATTAACCTTT
339 362 0.000770329 TGTGCTGTGGTCCCCGCATCAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-3*00(528.9) nan TRAJ6*00(299.6) TRAC*00(272.9) 426 436 460 0 10 50.0 nan 21 51 82 15 45 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGTCCCCGCATCAGGAGGAAGCTACATACCTACATTT
340 362 0.000770329 TGTGCCCCAACTGACAGCTGGGGGAAATTCCAGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(521.5) nan TRAJ24*00(270.3) TRAC*00(242.9) 432 438 462 0 6 30.0 nan 23 52 83 7 36 SG45C 129.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCCCAACTGACAGCTGGGGGAAATTCCAGTTT
343 357 0.000759689 TGTGCAGTTCCCCTTACCGGTTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(441.7) nan TRAJ42*00(300.4) TRAC*00(218.9) 417 424 446 0 7 35.0 nan 24 55 86 20 51 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGTTCCCCTTACCGGTTATGGAGGAAGCCAAGGAAATCTCATCTTT
345 353 0.000751177 TGCGGCACACTAACTTACACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV30*00(563.1) nan TRAJ49*00(262) TRAC*00(290.4) 423 432 456 0 9 45.0 nan 22 45 76 16 39 115.0 nan nan nan nan nan nan nan nan nan nan nan TGCGGCACACTAACTTACACCGGTAACCAGTTCTATTTT
346 352 0.000749049 TGTGTTCCCCGCCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(491.5) nan TRAJ34*00(235.3) TRAC*00(299.1) 423 427 455 0 4 20.0 nan 30 47 78 11 28 85.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTTCCCCGCCGACAAGCTCATCTTT
347 352 0.000749049 TGTGCAATGAGCTCTTATAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(542.6) nan TRAJ34*00(279.4) TRAC*00(272.7) 429 441 462 0 12 60.0 nan 20 47 78 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCTCTTATAACACCGACAAGCTCATCTTT
348 351 0.000746921 TGTGCAATCCCCCCAACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(457.9) nan TRAJ49*00(246.9) TRAC*00(266.4) 429 437 462 0 8 40.0 nan 24 45 76 15 36 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATCCCCCCAACCGGTAACCAGTTCTATTTT
349 350 0.000744793 TGCCTCGTGGGTGAAGGGGGGGCTGCAGGCAACAAGCTAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV4*00(507) nan TRAJ17*00(265.8) TRAC*00(298.3) 411 425 447 0 14 70.0 nan 28 52 83 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGCCTCGTGGGTGAAGGGGGGGCTGCAGGCAACAAGCTAACTTTT
350 347 0.000738409 TGTGCAATGAGCGCGGAAGATGACAAGATCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(592) nan TRAJ30*00(247.2) TRAC*00(256.5) 429 444 462 0 15 75.0 nan 27 46 77 17 36 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGCGGAAGATGACAAGATCATCTTT
352 343 0.000729897 TGTGCTCTAAGGGAGCGGAGGGTGGTACTAGCTATGGAAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV16*00(496.6) nan TRAJ52*00(301.6) TRAC*00(249.1) 414 425 448 0 11 55.0 nan 28 58 89 20 50 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAAGGGAGCGGAGGGTGGTACTAGCTATGGAAAGCTGACATTT
354 340 0.000723514 TGTGCAGAGAGTTCTGCATCAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(348.3) nan TRAJ6*00(303.7) TRAC*00(271.2) 426 438 459 0 12 60.0 nan 20 51 82 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGTTCTGCATCAGGAGGAAGCTACATACCTACATTT
355 338 0.000719258 TGTGCAATGAGCGCGATTGGAACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(527.3) nan TRAJ49*00(255.4) TRAC*00(240.9) 429 444 462 0 15 75.0 nan 24 45 76 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGCGATTGGAACCGGTAACCAGTTCTATTTT
356 337 0.00071713 TGTGCCGTGAACGATGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(646.5) nan TRAJ31*00(239.3) TRAC*00(229.5) 429 441 462 0 12 60.0 nan 25 46 77 9 30 SA28G 89.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACGATGCCAGACTCATGTTT
357 336 0.000715002 TGTGCCATAAACACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(617.7) nan TRAJ49*00(268.9) TRAC*00(231.9) 423 428 456 0 5 25.0 nan 21 45 76 9 33 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCATAAACACCGGTAACCAGTTCTATTTT
360 331 0.000704362 TGTGCTGTGAGTGAGTGGGGGGGGAATTATGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-2*00(391.3) nan TRAJ32*00(311.6) TRAC*00(172.8) 426 440 460 0 14 ST430C 54.0 nan 21 55 86 23 57 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGTGAGTGGGGGGGGAATTATGGTGGTGCTACAAACAAGCTCATCTTT
361 331 0.000704362 TGTGCAGGAGATCAGGATACCGGCACTGCCAGTAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(429.5) nan TRAJ44*00(284) TRAC*00(276.4) 417 427 447 0 10 50.0 nan 23 52 83 16 45 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGATCAGGATACCGGCACTGCCAGTAAACTCACCTTT
362 328 0.000697978 TGTGCTCTGAGTGAGGCGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(418.2) nan TRAJ45*00(289.8) TRAC*00(255.6) 432 450 469 0 18 90.0 nan 23 55 86 19 51 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT
363 327 0.00069585 TGTGCAGCCCCTGACGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(586) nan TRAJ4*00(256.9) TRAC*00(226.6) 423 431 456 0 8 40.0 nan 31 52 83 15 36 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCCCCTGACGGCTACAATAAGCTGATTTTT
364 322 0.00068521 TGTGCAGAGAGTATGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(525.9) nan TRAJ12*00(282) TRAC*00(247.7) 426 440 459 0 14 70.0 nan 22 49 80 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGTATGGATAGCAGCTATAAATTGATCTTC
366 320 0.000680954 TGTGCAGAGACCTCCGATAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(466.3) nan TRAJ26*00(272.6) TRAC*00(249.8) 426 436 459 0 10 50.0 nan 22 49 80 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGACCTCCGATAACTATGGTCAGAATTTTGTCTTT
368 319 0.000678826 TGCATCCCTCCTTTCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-2*00(489) nan TRAJ4*00(294.4) TRAC*00(303.4) 411 418 446 0 7 35.0 nan 23 52 83 11 40 145.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCCCTCCTTTCTGGTGGCTACAATAAGCTGATTTTT
374 307 0.00065329 TGCGCTGTGGGGGATGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV1-1*00(586.5) nan TRAJ9*00(263.2) TRAC*00(270.6) 411 420 445 0 9 45.0 nan 28 50 81 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGCGCTGTGGGGGATGGAGGCTTCAAAACTATCTTT
375 305 0.000649034 TGTGCTACGGCCGAGTACAATAACAATGACATGCGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(565.5) nan TRAJ43*00(276.3) TRAC*00(116.1) 423 433 456 0 10 50.0 nan 18 43 74 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGCCGAGTACAATAACAATGACATGCGCTTT
376 304 0.000646906 TGTGCTGTCATGCACATGAATTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV41*00(525.1) nan TRAJ42*00(335.6) TRAC*00(247.1) 423 433 455 0 10 50.0 nan 18 55 86 14 51 185.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTCATGCACATGAATTATGGAGGAAGCCAAGGAAATCTCATCTTT
377 301 0.000640522 TGTGCACCTAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(605.3) nan TRAJ34*00(262) TRAC*00(249.9) 417 423 447 0 6 30.0 nan 25 47 78 8 30 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCACCTAACACCGACAAGCTCATCTTT
378 298 0.000634138 TGTGCCCGGGGTTACCAGAAAGTTACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(505.4) nan TRAJ13*00(268.9) TRAC*00(262.4) 432 437 468 0 5 25.0 nan 29 52 83 7 30 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCCGGGGTTACCAGAAAGTTACCTTT
379 297 0.00063201 TGTGCTCTGAGTGTCATTACCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(515) nan TRAJ40*00(282.3) TRAC*00(263.7) 432 445 469 0 13 65.0 nan 22 50 81 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGTCATTACCTCAGGAACCTACAAATACATCTTT
380 296 0.000629882 TGTGCTTATAGGAGCGCGAGTCAGGGAGCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(504.1) nan TRAJ54*00(268) TRAC*00(243.7) 432 450 468 0 18 90.0 nan 24 49 80 20 45 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTATAGGAGCGCGAGTCAGGGAGCCCAGAAGCTGGTATTT
381 296 0.000629882 TGTGCTGTGCAGGCGGGCACCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(574) nan TRAJ40*00(276.5) TRAC*00(223.6) 423 437 456 0 14 70.0 nan 23 50 81 18 45 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGCAGGCGGGCACCTCAGGAACCTACAAATACATCTTT
383 296 0.000629882 TGTGCAATGAGAGAGGATCTGGGGCCCGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(420.5) nan TRAJ45*00(211.6) TRAC*00(294.6) 432 448 469 0 16 80.0 nan 42 55 86 26 39 65.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGATCTGGGGCCCGGACTCACCTTT
384 295 0.000627754 TGTGCCGTGAACCCGGGGGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(411.7) nan TRAJ32*00(272.7) TRAC*00(252.6) 429 441 462 0 12 60.0 nan 28 55 86 18 45 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACCCGGGGGGTGGTGCTACAAACAAGCTCATCTTT
385 295 0.000627754 TGTGCAGAGAAGAGGGATAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(485.2) nan TRAJ26*00(281.4) TRAC*00(245.3) 426 437 459 0 11 55.0 nan 20 49 80 13 42 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAAGAGGGATAACTATGGTCAGAATTTTGTCTTT
387 292 0.00062137 TGTGCCGTGAACGGTGCGGGCAGGAGAGCACTTACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(319) nan TRAJ5*00(268) TRAC*00(263.9) 429 441 462 0 12 60.0 nan 26 49 80 16 39 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACGGTGCGGGCAGGAGAGCACTTACTTTT
390 291 0.000619242 TGTGCAGAGAATATTTTCGCAGGGGGTTACCAGAAAGTTACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(466.7) nan TRAJ13*00(254.4) TRAC*00(271.1) 426 444 459 0 18 SA440T 74.0 nan 28 52 83 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAATATTTTCGCAGGGGGTTACCAGAAAGTTACCTTT
392 285 0.000606475 TGTGCTGTGAGTTTGAATTGGGACGATTAAATACCGGCACTGCCAGTAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-4*00(380.6) nan TRAJ44*00(311.8) TRAC*00(239.2) 426 438 460 0 12 60.0 nan 20 52 83 27 59 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGTTTGAATTGGGACGATTAAATACCGGCACTGCCAGTAAACTCACCTTT
393 283 0.000602219 TGTGCAGCAAGTACGGAGAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(521.4) nan TRAJ33*00(253.9) TRAC*00(257.2) 423 436 456 0 13 65.0 nan 21 46 77 14 39 ST24G 109.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTACGGAGAGCAACTATCAGTTAATCTGG
394 281 0.000597963 TGTCCTCCCTCTTTGAATAACAATGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(532.2) nan TRAJ31*00(271.9) TRAC*00(248.6) 423 426 457 0 3 15.0 nan 21 46 77 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTCCTCCCTCTTTGAATAACAATGCCAGACTCATGTTT
397 279 0.000593707 TGTGCCGGGGATTCTGGTTCTGCAAGGCAACTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(454.6) nan TRAJ22*00(286) TRAC*00(243.5) 429 436 462 0 7 35.0 nan 24 52 83 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGGGGATTCTGGTTCTGCAAGGCAACTGACCTTT
398 278 0.000591579 TGTGCCTTCAGGGGGGCCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(548.2) nan TRAJ49*00(242.7) TRAC*00(263.1) 432 440 462 0 8 40.0 nan 25 45 76 16 36 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTTCAGGGGGGCCGGTAACCAGTTCTATTTT
400 274 0.000583067 TGTGCCGTGAAGGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(323.5) nan TRAJ33*00(277.9) TRAC*00(264) 429 440 462 0 11 55.0 nan 21 46 77 11 36 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAAGGATAGCAACTATCAGTTAATCTGG
401 274 0.000583067 TGTGCAGAGATAGAACGCACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(443.1) nan TRAJ34*00(241.2) TRAC*00(272) 426 436 459 0 10 50.0 nan 28 47 78 17 36 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGATAGAACGCACCGACAAGCTCATCTTT
402 273 0.000580939 TGTGCCGTGAACAGGCGGGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(325.6) nan TRAJ31*00(227.6) TRAC*00(262.3) 429 442 462 0 13 65.0 nan 31 46 77 18 33 75.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACAGGCGGGCCAGACTCATGTTT
403 272 0.000578811 TGTGCTACGGCCGTAATAACCTCCTACGACAAGGTGATATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(159.7) nan TRAJ50*00(271.1) TRAC*00(205.8) 423 433 456 0 10 50.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGCCGTAATAACCTCCTACGACAAGGTGATATTT
404 272 0.000578811 TGTGCAATAAGAGCCTGGGGTCCTGGGGGTTACCAGAAAGTTACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(444.6) nan TRAJ13*00(274.4) TRAC*00(262.5) 429 437 462 0 8 40.0 nan 26 52 83 22 48 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATAAGAGCCTGGGGTCCTGGGGGTTACCAGAAAGTTACCTTT
406 268 0.000570299 TGTGCAATGAGCGCGAAAGACGACATGCGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(626.5) nan TRAJ43*00(208.2) TRAC*00(225.3) 429 444 462 0 15 75.0 nan 31 43 74 21 33 60.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGCGAAAGACGACATGCGCTTT
409 264 0.000561787 TGTGCAGCAAGTAAGCCCCTTGACTCCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(468.2) nan TRAJ40*00(264.4) TRAC*00(254.4) 423 436 456 0 13 65.0 nan 24 50 81 25 51 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTAAGCCCCTTGACTCCTCAGGAACCTACAAATACATCTTT
410 263 0.000559659 TGTGCTCTGGGGGACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(625.2) nan TRAJ3*00(290.8) TRAC*00(233.6) 432 441 469 0 9 45.0 nan 20 51 82 8 39 ST24G 139.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGGGGGACAGCAGTGCTTCCAAGATAATCTTT
411 261 0.000555403 TGTGCTTTCATGAAGCCACATGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-1*00(488.1) nan TRAJ32*00(289.1) TRAC*00(243.3) 432 448 469 0 16 80.0 nan 26 55 86 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTTCATGAAGCCACATGGTGGTGCTACAAACAAGCTCATCTTT
412 261 0.000555403 TGTGCTTATAGGACCCCTGGGAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(215.5) nan TRAJ48*00(242.8) TRAC*00(219) 432 445 468 0 13 65.0 nan 30 52 83 17 39 SA33G 94.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTATAGGACCCCTGGGAATGAGAAATTAACCTTT
413 261 0.000555403 TGTGCCGTTTATAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(510.8) nan TRAJ27*00(300.1) TRAC*00(287.6) 429 437 462 0 8 40.0 nan 17 48 79 8 39 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTTTATAACACCAATGCAGGCAAATCAACCTTT
414 259 0.000551147 TGTGTGGTGAACCGGTCTGGTTCTGCAAGGCAACTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(507.3) nan TRAJ22*00(277.8) TRAC*00(265) 423 435 456 0 12 60.0 nan 25 52 83 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAACCGGTCTGGTTCTGCAAGGCAACTGACCTTT
416 258 0.000549019 TGTGCAGGGCTTATCCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(510.5) nan TRAJ15*00(275.2) TRAC*00(279.7) 417 427 446 0 10 50.0 nan 24 49 80 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGCTTATCCAGGCAGGAACTGCTCTGATCTTT
420 248 0.000527739 TGTGCTGTTTGCCCTTCAGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(436.3) nan TRAJ16*00(260.6) TRAC*00(273.2) 423 431 455 0 8 40.0 nan 24 49 80 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTTGCCCTTCAGATGGCCAGAAGCTGCTCTTT
422 247 0.000525611 TGTGCAGCGGCGCGAGGATACAGCACTCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(499.1) nan TRAJ11*00(237.4) TRAC*00(237.5) 423 431 456 0 8 40.0 nan 27 49 80 14 36 SC39T 94.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCGGCGCGAGGATACAGCACTCTCACCTTT
423 247 0.000525611 TGTGCAGCAAGTATACAGGGCGGATCTGAAAAGCTGGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(213.1) nan TRAJ57*00(286.4) TRAC*00(230.9) 444 455 477 0 11 55.0 nan 25 52 83 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTATACAGGGCGGATCTGAAAAGCTGGTCTTT
424 245 0.000521355 TGTGCAGGTCGTCAAGTCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV25*00(472.7) nan TRAJ10*00(290.3) TRAC*00(255.1) 417 425 446 0 8 40.0 nan 24 53 84 16 45 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGTCGTCAAGTCACGGGAGGAGGAAACAAACTCACCTTT
425 243 0.000517099 TGTGCTGTGGCCGGAACAACTGACAGCTGGGGGAAATTCCAGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(164.3) nan TRAJ24*00(287) TRAC*00(274.4) 423 433 457 0 10 50.0 nan 22 52 83 15 45 SG45C 134.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGCCGGAACAACTGACAGCTGGGGGAAATTCCAGTTT
429 240 0.000510715 TGTGCTCTGAGTGAAGTAAACTCTGGGGCTGGGAGTTACCAACTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(541.6) nan TRAJ28*00(298.8) TRAC*00(118.2) 432 446 469 0 14 70.0 nan 23 55 86 19 51 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAAGTAAACTCTGGGGCTGGGAGTTACCAACTCACTTTC
430 238 0.000506459 TGTGCCGTGAAGGGAACTGGGGCAAACAACCTCTTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(506.4) nan TRAJ36*00(266.2) TRAC*00(262.7) 429 440 462 0 11 55.0 nan 23 48 79 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAAGGGAACTGGGGCAAACAACCTCTTCTTT
431 236 0.000502204 TGTGCAGTAATTTATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(456.3) nan TRAJ23*00(288.2) TRAC*00(261.7) 429 435 462 0 6 30.0 nan 22 52 83 9 39 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGTAATTTATAACCAGGGAGGAAAGCTTATCTTC
432 235 0.000500076 TGTGCTTATAGGAGCGACAATTATGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(445.7) nan TRAJ32*00(305.9) TRAC*00(237.5) 432 448 468 0 16 80.0 nan 22 55 86 18 51 165.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTATAGGAGCGACAATTATGGTGGTGCTACAAACAAGCTCATCTTT
436 232 0.000493692 TGTGCTCTGAGTGAGGCGAAGCAGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(192.9) nan TRAJ45*00(306.4) TRAC*00(218.6) 432 450 469 0 18 90.0 nan 23 55 86 25 57 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGAAGCAGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT
437 232 0.000493692 TGTGCCCCTAAGAGAGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(556.9) nan TRAJ16*00(254.7) TRAC*00(259.9) 429 435 462 0 6 30.0 nan 27 49 80 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCCCTAAGAGAGATGGCCAGAAGCTGCTCTTT
438 232 0.000493692 TGTGCAGCAAGTCCCTGGAGCCAATAGTAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(532.8) nan TRAJ56*00(275.3) TRAC*00(244.2) 423 435 456 0 12 60.0 nan 25 51 82 14 40 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTCCCTGGAGCCAATAGTAAGCTGACATTT
439 231 0.000491564 TGTGCTCTGACCAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(569.4) nan TRAJ21*00(256.4) TRAC*00(249) 432 442 469 0 10 50.0 nan 22 44 75 11 33 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGACCAACTTCAACAAATTTTACTTT
443 229 0.000487308 TGTGCTCTGATTCCGTACACGGGCAGGAGAGCACTTACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(437.1) nan TRAJ5*00(273.2) TRAC*00(258.1) 432 442 469 0 10 50.0 nan 23 49 80 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGATTCCGTACACGGGCAGGAGAGCACTTACTTTT
446 228 0.00048518 TGTGCAATGAGAGACCACGACAGAGGCTCAACCCTGGGGAGGCTATACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(257.1) nan TRAJ18*00(315.8) TRAC*00(244.3) 432 446 469 0 14 70.0 nan 21 55 86 17 51 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGACCACGACAGAGGCTCAACCCTGGGGAGGCTATACTTT
447 228 0.00048518 TGTGGCACAGAGGTGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV30*00(581.6) nan TRAJ12*00(280.1) TRAC*00(257.6) 423 435 456 0 12 SC425T 44.0 nan 23 49 80 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGGCACAGAGGTGGATAGCAGCTATAAATTGATCTTC
448 227 0.000483052 TGTGCCGTGAACTCATATCGGCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(557.6) nan TRAJ15*00(258.1) TRAC*00(201.8) 429 441 462 0 12 60.0 nan 25 49 80 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACTCATATCGGCAGGCAGGAACTGCTCTGATCTTT
449 225 0.000478796 TGTGCAGTCCCCAGTAGAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(509) nan TRAJ3*00(250) TRAC*00(243) 426 433 459 0 7 35.0 nan 30 51 82 17 38 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGTCCCCAGTAGAGTGCTTCCAAGATAATCTTT
450 222 0.000472412 TGTGCTACGGACGAGCACGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(586.5) nan TRAJ3*00(260.7) TRAC*00(247.2) 423 436 456 0 13 65.0 nan 28 51 82 18 41 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGAGCACGCAGTGCTTCCAAGATAATCTTT
451 220 0.000468156 TGCATCGTCAGAGTCTAGGGGGAGTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-1*00(149.5) nan TRAJ42*00(295.7) TRAC*00(209.5) 411 426 447 0 15 75.0 nan 25 55 86 24 54 150.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCGTCAGAGTCTAGGGGGAGTATGGAGGAAGCCAAGGAAATCTCATCTTT
452 219 0.000466028 TGTGCTCTGAGTGATGGTTATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(578.3) nan TRAJ23*00(286.9) TRAC*00(226.7) 432 446 469 0 14 70.0 nan 24 52 83 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGATGGTTATAACCAGGGAGGAAAGCTTATCTTC
453 218 0.0004639 TGTGCCGTGAATCTGATAAAGAAAGGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(418.4) nan TRAJ33*00(249.8) TRAC*00(236.5) 429 440 462 0 11 55.0 nan 26 46 77 25 45 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAATCTGATAAAGAAAGGCAACTATCAGTTAATCTGG
454 217 0.000461772 TGTGCAGCAAGTATACCCCAGGGAGCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(503.4) nan TRAJ54*00(263.3) TRAC*00(213.1) 423 439 456 0 16 80.0 nan 25 49 80 18 42 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTATACCCCAGGGAGCCCAGAAGCTGGTATTT
455 215 0.000457516 TGTGCTCTGAATCAACTCAGGGCGGATCTGAAAAGCTGGCCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(490.1) nan TRAJ57*00(285.3) TRAC*00(246.1) 432 442 469 0 10 50.0 nan 21 52 83 13 44 ST47C 139.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAATCAACTCAGGGCGGATCTGAAAAGCTGGCCTTT
458 212 0.000451132 TGTGCTACGGACGGCCAAACTGGGGCAAACAACCTCTTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(176.1) nan TRAJ36*00(280.6) TRAC*00(232.8) 423 436 456 0 13 65.0 nan 21 48 79 15 42 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGGCCAAACTGGGGCAAACAACCTCTTCTTT
459 212 0.000451132 TGCGGCTTTACTGGAGCCAATAGTAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV30*00(523.6) nan TRAJ56*00(281.1) TRAC*00(243) 423 429 456 0 6 30.0 nan 23 51 82 8 36 140.0 nan nan nan nan nan nan nan nan nan nan nan TGCGGCTTTACTGGAGCCAATAGTAAGCTGACATTT
461 210 0.000446876 TGTGCTGTGAATGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(564.6) nan TRAJ39*00(269.6) TRAC*00(240.8) 423 432 456 0 9 45.0 nan 28 52 83 9 33 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAATGCAGGCAACATGCTCACCTTT
462 210 0.000446876 TGTGCTGGGCAGCTCAAGTGGTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV35*00(559.5) nan TRAJ40*00(269.6) TRAC*00(302.1) 417 431 449 0 14 70.0 nan 26 50 81 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGGGCAGCTCAAGTGGTCAGGAACCTACAAATACATCTTT
466 205 0.000436236 TGTGCTGTTGTCCCGGTTCGGAGAGATGACAAGATCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(497.2) nan TRAJ30*00(255) TRAC*00(245.6) 423 431 455 0 8 40.0 nan 25 46 77 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTGTCCCGGTTCGGAGAGATGACAAGATCATCTTT
467 205 0.000436236 TGTGCCGTAGCGATAGGCTTTGGGAATGTGCTGCATCGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(529.8) nan TRAJ35*00(275) TRAC*00(243.3) 429 437 462 0 8 40.0 nan 19 48 79 10 39 ST45C 129.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTAGCGATAGGCTTTGGGAATGTGCTGCATCGC
469 202 0.000429852 TGTGCTTATAGGAGCGCGTAGGAAATTAGAAGGGCGGATCTGAAAAGCTGGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(234.7) nan TRAJ57*00(277.6) TRAC*00(236.2) 432 450 468 0 18 90.0 nan 26 52 83 30 56 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTATAGGAGCGCGTAGGAAATTAGAAGGGCGGATCTGAAAAGCTGGTCTTT
470 202 0.000429852 TGTGCTCTGGAAAACAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV9-2*00(212.2) nan TRAJ21*00(265.2) TRAC*00(172.3) 423 432 457 0 9 45.0 nan 21 44 75 13 36 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGGAAAACAACTTCAACAAATTTTACTTT
474 196 0.000417084 TGCCTCGTCCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNN TRAV4*00(475.9) nan TRAJ27*00(195) TRAC*00(276.3) 411 419 447 0 8 40.0 nan 35 48 79 9 22 65.0 nan nan nan nan nan nan nan nan nan nan nan TGCCTCGTCCAAATCAACCTTT
476 193 0.0004107 TGTGCTGTTCACCTTCTTACCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(538.9) nan TRAJ4*00(274.9) TRAC*00(219.1) 423 431 456 0 8 40.0 nan 26 52 83 20 46 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTCACCTTCTTACCTGGTGGCTACAATAAGCTGATTTTT
478 193 0.0004107 TGTGCGGCAAGTAAGCCCCTTGACTCCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(524.7) nan TRAJ40*00(279.1) TRAC*00(257.2) 423 436 456 0 13 SA428G 49.0 nan 24 50 81 25 51 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCGGCAAGTAAGCCCCTTGACTCCTCAGGAACCTACAAATACATCTTT
479 193 0.0004107 TGCATCCTGAGAGTCCAATACCGGCACTGCCAGTAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-2*00(440.8) nan TRAJ44*00(298.6) TRAC*00(242.8) 411 424 446 0 13 65.0 nan 22 52 83 16 46 150.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCCTGAGAGTCCAATACCGGCACTGCCAGTAAACTCACCTTT
480 192 0.000408572 TGTGCTGTGAGTGAGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-6*00(460.7) nan TRAJ45*00(312.5) TRAC*00(261.4) 426 440 460 0 14 70.0 nan 23 55 86 16 48 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGTGAGGATTCAGGAGGAGGTGCTGACGGACTCACCTTT
482 189 0.000402188 TGTGCAGGAGGGGGGGATTCAGGAAACACACCTCTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV27*00(483.7) nan TRAJ29*00(279.3) TRAC*00(248.9) 417 427 447 0 10 50.0 nan 23 49 80 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGGGGGGGATTCAGGAAACACACCTCTTGTCTTT
483 188 0.00040006 TGTGCTCTGAGTGAGGCAGGAAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV9-2*00(461.4) nan TRAJ33*00(248.6) TRAC*00(271.8) 423 437 457 0 14 70.0 nan 25 46 77 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCAGGAAGCAACTATCAGTTAATCTGG
484 187 0.000397932 TGTGCTCTGAGAACGGGTAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV9-2*00(494.1) nan TRAJ33*00(253) TRAC*00(287.7) 423 434 457 0 11 55.0 nan 24 46 77 17 39 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGAACGGGTAGCAACTATCAGTTAATCTGG
485 187 0.000397932 TGTGCCCCGATCGGGGGTTCAGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(490.4) nan TRAJ16*00(267.8) TRAC*00(274.1) 429 435 462 0 6 30.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCCCGATCGGGGGTTCAGATGGCCAGAAGCTGCTCTTT
486 186 0.000395804 TGTGCCGTCCCATGGGCCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(606.3) nan TRAJ40*00(279.1) TRAC*00(243.2) 429 437 462 0 8 40.0 nan 24 50 81 16 42 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTCCCATGGGCCTCAGGAACCTACAAATACATCTTT
487 185 0.000393676 TGTGCCGTACAAGGATACGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(485.9) nan TRAJ42*00(288.4) TRAC*00(209) 429 437 462 0 8 40.0 nan 28 55 86 18 45 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTACAAGGATACGGAGGAAGCCAAGGAAATCTCATCTTT
488 184 0.000391549 TGTGTGGCATCCCCCCCGGGGTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(465.4) nan TRAJ33*00(224.4) TRAC*00(251.3) 423 430 456 0 7 35.0 nan 31 46 77 21 36 75.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGCATCCCCCCCGGGGTATCAGTTAATCTGG
489 182 0.000387293 TGTGCTCTGAGTGAGGGGAATACTGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(442.5) nan TRAJ9*00(280.5) TRAC*00(242.4) 432 448 469 0 16 80.0 nan 23 50 81 18 45 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGGGAATACTGGAGGCTTCAAAACTATCTTT
490 179 0.000380909 TGTGCCTCCCCCCATAATAATGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(164.3) nan TRAJ39*00(296.8) TRAC*00(250.1) 432 439 462 0 7 35.0 nan 23 52 83 13 42 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTCCCCCCATAATAATGCAGGCAACATGCTCACCTTT
492 173 0.000368141 TGCCTCGTGGGTGACCGCAATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV4*00(420) nan TRAJ42*00(290.1) TRAC*00(247.2) 411 426 447 0 15 75.0 nan 26 55 86 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGCCTCGTGGGTGACCGCAATGGAGGAAGCCAAGGAAATCTCATCTTT
493 170 0.000361757 TGTGCTCTGAGTGAGGCGAAGCAGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAATCATCCAGCCCTAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(148.8) nan TRAJ27*00(290.9) TRAC*00(233) 432 450 469 0 18 90.0 nan 20 48 79 129 157 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGAAGCAGGATTCAGGAGGAGGTGCTGACGGACTCACCTTTGGCAAAGGGACTCATCTAATCATCCAGCCCTAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT
495 166 0.000353245 TGTGCAATGAGAGAGGCCCGTAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(580.3) nan TRAJ34*00(255.6) TRAC*00(116.3) 432 448 469 0 16 80.0 nan 25 47 78 20 42 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGCCCGTAACACCGACAAGCTCATCTTT
496 165 0.000351117 TGTGCTGTGAGAGATGGCTCAAATTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV1-2*00(545.7) nan TRAJ41*00(283.7) TRAC*00(237.9) 411 426 445 0 15 75.0 nan 23 51 82 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGATGGCTCAAATTCCGGGTATGCACTCAACTTC
499 160 0.000340477 TGTGCAGCAAGCGGAGGCTCAACCCTGGGGAGGCTATACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(188.9) nan TRAJ18*00(298.3) TRAC*00(253.2) 444 457 477 0 13 65.0 nan 26 55 86 13 42 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGGAGGCTCAACCCTGGGGAGGCTATACTTT
501 158 0.000336221 TGTGCTCTAGACAGGGGCAAAGCTGCAGGCAACAAGCTAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV6*00(441.8) nan TRAJ17*00(288.5) TRAC*00(299.8) 426 439 459 0 13 65.0 nan 24 52 83 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAGACAGGGGCAAAGCTGCAGGCAACAAGCTAACTTTT
502 157 0.000334093 TGTGCTACGGACAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(561.4) nan TRAJ26*00(261.6) TRAC*00(213.3) 423 435 456 0 12 60.0 nan 21 49 80 8 36 ST24C 124.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACAACTATGGTCAGAATTTTGTCTTT
503 157 0.000334093 TGTGCCGTGAACCCTAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-1*00(582) nan TRAJ34*00(248.6) TRAC*00(248.3) 426 437 460 0 11 55.0 nan 25 47 78 14 36 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACCCTAACACCGACAAGCTCATCTTT
506 154 0.000327709 TGTGCTGTGGTTCCCGCATCAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-3*00(597.1) nan TRAJ6*00(302.7) TRAC*00(228.6) 426 436 460 0 10 50.0 nan 21 51 82 15 45 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGTTCCCGCATCAGGAGGAAGCTACATACCTACATTT
507 150 0.000319197 TGTGCAGCAAGCACCCTGCTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV23DV6*00(386.9) nan TRAJ48*00(273.1) TRAC*00(266.1) 450 463 483 0 13 65.0 nan 27 52 83 18 43 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCACCCTGCTTTGGAAATGAGAAATTAACCTTT
510 148 0.000314941 TGTGCAGAGAATAAGGCGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(639.1) nan TRAJ20*00(244.2) TRAC*00(261.8) 426 439 459 0 13 65.0 nan 27 46 77 16 35 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAATAAGGCGACTACAAGCTCAGCTTT
511 147 0.000312813 TGTGCTGTGGAGTTTACAGGCTTTCAGAAACTTGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(557.2) nan TRAJ8*00(261.3) TRAC*00(243.7) 423 435 457 0 12 60.0 nan 25 49 80 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAGTTTACAGGCTTTCAGAAACTTGTATTT
515 139 0.000295789 TGTGCTGTGAGAGGTCGAAACAAACTGGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(443) nan TRAJ47*00(227.9) TRAC*00(250.9) 426 439 462 0 13 65.0 nan 29 46 77 16 33 85.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGGTCGAAACAAACTGGTCTTT
516 136 0.000289405 TGTGCAGAGAGCCCCTTTTCAGGAAACACACCTCTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(507) nan TRAJ29*00(270.8) TRAC*00(210.5) 426 437 459 0 11 55.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGCCCCTTTTCAGGAAACACACCTCTTGTCTTT
517 135 0.000287277 TGTGCTCTTGGGAAGGGACTCGACTCAAATTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRDV1*00(172) nan TRAJ41*00(294.1) TRAC*00(253.6) 429 441 466 0 12 60.0 nan 22 51 82 22 51 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTTGGGAAGGGACTCGACTCAAATTCCGGGTATGCACTCAACTTC
518 134 0.000285149 TGTGCCTCCCCAACTGACAGCTGGGGGAAATTCCAGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(514.1) nan TRAJ24*00(273.3) TRAC*00(210.1) 432 439 462 0 7 35.0 nan 23 52 83 10 39 SG45C 129.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTCCCCAACTGACAGCTGGGGGAAATTCCAGTTT
519 133 0.000283021 TGTGCAATGAGAGAGTCCCCTTGGTATACAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(539) nan TRAJ6*00(281.1) TRAC*00(249.7) 432 447 469 0 15 75.0 nan 25 51 82 28 54 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGTCCCCTTGGTATACAGGAGGAAGCTACATACCTACATTT
520 132 0.000280893 TGTGCTACTCAGAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(153.8) nan TRAJ48*00(287.6) TRAC*00(242.8) 423 431 456 0 8 40.0 nan 25 52 83 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACTCAGAACTTTGGAAATGAGAAATTAACCTTT
522 129 0.00027451 TGTGTGGTGAGCCTCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV10*00(517.8) nan TRAJ10*00(291.8) TRAC*00(255.2) 429 441 462 0 12 60.0 nan 23 53 84 12 42 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAGCCTCACGGGAGGAGGAAACAAACTCACCTTT
523 129 0.00027451 TGTGCTCTGAGTCATTTATCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(508) nan TRAJ40*00(265.7) TRAC*00(254.7) 432 444 469 0 12 60.0 nan 26 50 81 18 42 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTCATTTATCAGGAACCTACAAATACATCTTT
524 129 0.00027451 TGTGCCGTGGACTCCCGATACAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV39*00(172.3) nan TRAJ21*00(277) TRAC*00(259.1) 417 429 450 0 12 60.0 nan 19 44 75 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGGACTCCCGATACAACTTCAACAAATTTTACTTT
525 127 0.000270254 TGTGCTTATGACGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(195.5) nan TRAJ42*00(283.9) TRAC*00(156.6) 432 441 468 0 9 45.0 nan 28 55 86 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTATGACGGAGGAAGCCAAGGAAATCTCATCTTT
526 127 0.000270254 TGTGCTGGCGATAAGGATCAGGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(375.9) nan TRAJ6*00(281) TRAC*00(245.2) 423 430 457 0 7 35.0 nan 23 51 82 16 44 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGGCGATAAGGATCAGGAGGAAGCTACATACCTACATTT
527 127 0.000270254 TGTGCAGATAGATGACAAGATCATCTTTGGAAAAGGGACACGACTTCATATTCTCCCCAAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(183.5) nan TRAJ27*00(287.8) TRAC*00(270.5) 426 434 459 0 8 40.0 nan 20 48 79 100 128 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGATAGATGACAAGATCATCTTTGGAAAAGGGACACGACTTCATATTCTCCCCAAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT
529 122 0.000259614 TGTGCAGCAAGTATCGGAAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(510.7) nan TRAJ3*00(269) TRAC*00(295.9) 423 437 456 0 14 70.0 nan 27 51 82 18 42 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTATCGGAAGCAGTGCTTCCAAGATAATCTTT
530 122 0.000259614 TGCATCGTCAGATTGTCCGGGTTTTCAGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-1*00(128.8) nan TRAJ16*00(287.7) TRAC*00(234.1) 411 423 447 0 12 60.0 nan 20 49 80 19 48 145.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCGTCAGATTGTCCGGGTTTTCAGATGGCCAGAAGCTGCTCTTT
534 116 0.000246846 TGTGCTGTTCCCCCTTATAACCAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(554.9) nan TRAJ23*00(290.6) TRAC*00(242.7) 423 431 456 0 8 40.0 nan 24 52 83 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTCCCCCTTATAACCAGGGAGGAAAGCTTATCTTC
536 115 0.000244718 TGTGTGGTGAACCGGTCTGGTTCTGCAAGGCAGCTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(572.9) nan TRAJ22*00(263.3) TRAC*00(238.9) 423 435 456 0 12 60.0 nan 25 52 83 15 42 SA42G 119.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGAACCGGTCTGGTTCTGCAAGGCAGCTGACCTTT
537 115 0.000244718 TGTGCCGTAATTATGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(530.3) nan TRAJ12*00(282) TRAC*00(261) 429 437 462 0 8 40.0 nan 22 49 80 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTAATTATGGATAGCAGCTATAAATTGATCTTC
543 107 0.000227694 TGTGCAGCAAGTAGGGACCCGACCGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(576.6) nan TRAJ49*00(253.9) TRAC*00(237.7) 423 436 456 0 13 65.0 nan 24 45 76 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTAGGGACCCGACCGGTAACCAGTTCTATTTT
545 106 0.000225566 TGCATCGTCGTCCACTTATGGAGGAAGCCAAGGAAATCTCATCTTTGGAAAAGGCACTAAACTCTCTGTTAAACCAAAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-1*00(143.5) nan TRAJ27*00(291.5) TRAC*00(259.8) 411 420 447 0 9 45.0 nan 20 48 79 118 146 140.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCGTCGTCCACTTATGGAGGAAGCCAAGGAAATCTCATCTTTGGAAAAGGCACTAAACTCTCTGTTAAACCAAAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT
550 103 0.000219182 TGTGCTGTGGGTACCTCAGGAACCTACAAATACATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-3*00(561.5) nan TRAJ40*00(291.6) TRAC*00(249.3) 426 438 460 0 12 60.0 nan 22 50 81 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGGTACCTCAGGAACCTACAAATACATCTTT
551 103 0.000219182 TGTGCTGTGAGAGACATCCTCTCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(555.6) nan TRAJ4*00(282.6) TRAC*00(170.7) 426 443 462 0 17 85.0 nan 25 52 83 21 48 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACATCCTCTCTGGTGGCTACAATAAGCTGATTTTT
556 97 0.000206414 TGTGCCGTGATTCAGGGAGCCCAGAAGCTGGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV39*00(524.3) nan TRAJ54*00(278.7) TRAC*00(274.2) 417 426 450 0 9 45.0 nan 22 49 80 9 36 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGATTCAGGGAGCCCAGAAGCTGGTATTT
557 97 0.000206414 TGTGCCGGCTCTGATGACAAGATCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(475.7) nan TRAJ30*00(242.7) TRAC*00(228.6) 429 436 462 0 7 35.0 nan 28 46 77 12 30 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGGCTCTGATGACAAGATCATCTTT
558 96 0.000204286 TGTGCAATGAGAGAGGGGGGGAACTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(256.8) nan TRAJ21*00(255.9) TRAC*00(250.7) 432 449 469 0 17 85.0 nan 23 44 75 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGGGGGGAACTTCAACAAATTTTACTTT
561 92 0.000195774 TGTGCTTCTTCGGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(533.1) nan TRAJ33*00(273) TRAC*00(262.6) 432 439 468 0 7 35.0 nan 21 46 77 11 36 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTCTTCGGATAGCAACTATCAGTTAATCTGG
563 92 0.000195774 TGTGGAGCAGGCATGGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV34*00(625.5) nan TRAJ33*00(288.1) TRAC*00(243.3) 423 438 456 0 15 SA433G 59.0 nan 18 46 77 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGGAGCAGGCATGGATAGCAACTATCAGTTAATCTGG
564 89 0.00018939 TGTGCAATGAGCGAGGAAGGCTTTGGGAATGTGCTGCATTGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(455.8) nan TRAJ35*00(259.5) TRAC*00(283.1) 429 442 462 0 13 65.0 nan 23 48 79 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGAGGAAGGCTTTGGGAATGTGCTGCATTGC
568 81 0.000172366 TGTGCAGCACGTATATCTCTTATTACTGGCAACACAGGCAAACTAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV23DV6*00(417.2) nan TRAJ37*00(265.7) TRAC*00(254.4) 450 459 483 0 9 45.0 nan 25 51 82 25 51 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCACGTATATCTCTTATTACTGGCAACACAGGCAAACTAATCTTT
569 80 0.000170238 TGTGCCGTCCGAAGAGGAAGCTACATACCTACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(247.3) nan TRAJ6*00(269.1) TRAC*00(295.8) 429 437 462 0 8 40.0 nan 28 51 82 13 36 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTCCGAAGAGGAAGCTACATACCTACATTT
571 78 0.000165983 TGTGTGGGACATAATGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(288.1) nan TRAJ39*00(265) TRAC*00(232.3) 423 430 456 0 7 35.0 nan 26 52 83 10 36 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGGACATAATGCAGGCAACATGCTCACCTTT
572 78 0.000165983 TGTGCTGTGCGGTCAGATGACAAGATCATCTTTGGAAAAGGGACACGACTTCATATTCTCCCCAAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV20*00(178) nan TRAJ27*00(287.6) TRAC*00(262.7) 423 433 456 0 10 50.0 nan 20 48 79 105 133 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGCGGTCAGATGACAAGATCATCTTTGGAAAAGGGACACGACTTCATATTCTCCCCAAGGCCTGAGTCAAGGTTATTGCAATAGCACTAAAGACTGTGTAACACCAATGCAGGCAAATCAACCTTT
574 77 0.000163855 TGTGCTGTGAGGCCTTTACAGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(501.4) nan TRAJ23*00(247.1) TRAC*00(258) 426 437 462 0 11 55.0 nan 31 52 83 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGGCCTTTACAGGGAGGAAAGCTTATCTTC
575 77 0.000163855 TGTGCTGTGAAGGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV1-2*00(490.9) nan TRAJ33*00(262.3) TRAC*00(206.6) 411 421 445 0 10 50.0 nan 21 46 77 11 36 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAAGGATAGCAACTATCAGTTAATCTGG
576 76 0.000161727 TGTGCCTCGGAAACCTCCTACGACAAGGTGATATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(320.9) nan TRAJ50*00(282.2) TRAC*00(247.3) 432 439 462 0 7 35.0 nan 23 49 80 10 36 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTCGGAAACCTCCTACGACAAGGTGATATTT
578 74 0.000157471 TGTGCTGTGAGAGACAACTATCAGTTAATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(526.2) nan TRAJ33*00(234.2) TRAC*00(246.6) 426 442 462 0 16 80.0 nan 27 46 77 14 33 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACAACTATCAGTTAATCTGG
579 74 0.000157471 TGTGCAATGAGCGCGGGTAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(620) nan TRAJ49*00(235.3) TRAC*00(212.8) 429 444 462 0 15 75.0 nan 27 45 76 15 33 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGCGGGTAACCAGTTCTATTTT
580 73 0.000155343 TGTGCAGACGCCTTAAATTCCGGGTATGCACTCAACTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(147.1) nan TRAJ41*00(271.8) TRAC*00(243.5) 426 434 459 0 8 40.0 nan 26 51 82 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGACGCCTTAAATTCCGGGTATGCACTCAACTTC
583 71 0.000151087 TGTGCTGTGAGAAGTATCACGGGCAGGAGAGCACTTACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(426.7) nan TRAJ5*00(267) TRAC*00(266.1) 426 438 462 0 12 60.0 nan 24 49 80 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAAGTATCACGGGCAGGAGAGCACTTACTTTT
587 66 0.000140447 TGTGTTGTGAGTGATCGGTACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-2*00(667.9) nan TRAJ34*00(252.8) TRAC*00(222.1) 426 442 460 0 16 80.0 nan 27 47 78 19 39 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTTGTGAGTGATCGGTACACCGACAAGCTCATCTTT
588 66 0.000140447 TGTGCTGTGAGAGACGTGGACACAGGCTTTCAGAAACTTGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(510.4) nan TRAJ8*00(274.1) TRAC*00(241.4) 426 441 462 0 15 75.0 nan 23 49 80 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACGTGGACACAGGCTTTCAGAAACTTGTATTT
590 65 0.000138319 TGTGCTAGGAAACTTTCGAACACAGGCTTTCAGAAACTTGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV9-2*00(490.7) nan TRAJ8*00(287.7) TRAC*00(211.8) 423 429 457 0 6 30.0 nan 21 49 80 17 45 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTAGGAAACTTTCGAACACAGGCTTTCAGAAACTTGTATTT
595 59 0.000125551 TGTGCTGTGAGGTCTTATAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(502.3) nan TRAJ34*00(269.9) TRAC*00(234.8) 426 437 462 0 11 55.0 nan 20 47 78 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGGTCTTATAACACCGACAAGCTCATCTTT
596 59 0.000125551 TGTGCTGTGAGGGCAAATAGTGGAGGTAGCAACTATAAACTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV22*00(424.5) nan TRAJ53*00(313.8) TRAC*00(301.7) 417 426 450 0 9 45.0 nan 22 55 86 15 48 165.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGGGCAAATAGTGGAGGTAGCAACTATAAACTGACATTT
597 59 0.000125551 TGTGCCGTGAACATTGGCTTCAACAAATTTTACTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(333.3) nan TRAJ21*00(248.7) TRAC*00(265.4) 429 443 462 0 14 70.0 nan 25 44 75 17 36 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACATTGGCTTCAACAAATTTTACTTT
598 59 0.000125551 TGTGCAGCAAGCGCGGACTACCCTCCCGGAAAGCTGACATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(214.6) nan TRAJ52*00(221.4) TRAC*00(269.4) 444 459 477 0 15 75.0 nan 43 58 89 27 42 75.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGCGGACTACCCTCCCGGAAAGCTGACATTT
599 57 0.000121295 TGTGCAATGAGTTCGGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-3*00(541.2) nan TRAJ4*00(270.4) TRAC*00(241.5) 429 440 462 0 11 55.0 nan 24 52 83 11 39 ST27G 124.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGTTCGGGTGGCTACAATAAGCTGATTTTT
600 55 0.000117039 TGTGCAATGAGAGAGGGGGGAACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(546.1) nan TRAJ34*00(239.5) TRAC*00(300.5) 432 449 469 0 17 85.0 nan 29 47 78 21 39 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGGGGGAACCGACAAGCTCATCTTT
602 52 0.000110655 TGTGCAGAGAGTGGAGGGGACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(493.4) nan TRAJ34*00(242.9) TRAC*00(274.6) 426 438 459 0 12 60.0 nan 27 47 78 19 39 100.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAGTGGAGGGGACACCGACAAGCTCATCTTT
603 52 0.000110655 TGCATCGTCGTCCACTTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV26-1*00(162.8) nan TRAJ42*00(307.3) TRAC*00(257.5) 411 420 447 0 9 45.0 nan 24 55 86 15 46 155.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCGTCGTCCACTTATGGAGGAAGCCAAGGAAATCTCATCTTT
604 47 0.000100015 TGTGCTGTGAGAGACATCGCCTTGGAGGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(510.7) nan TRAJ20*00(225.1) TRAC*00(244.5) 426 443 462 0 17 85.0 nan 28 46 77 27 45 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACATCGCCTTGGAGGACTACAAGCTCAGCTTT
607 45 9.57591e-05 TGTGTTGTGAGTGGGGAGTGACAGCTGGGGGAAATTCCAGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-2*00(518.9) nan TRAJ24*00(254) TRAC*00(304.8) 426 439 460 0 13 65.0 nan 27 52 83 18 43 SG45C 109.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTTGTGAGTGGGGAGTGACAGCTGGGGGAAATTCCAGTTT
611 41 8.72472e-05 TGTGCAGCAGGGGGAGGAGGTGCTGACGGACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV23DV6*00(124.6) nan TRAJ45*00(269.2) TRAC*00(150.7) 450 459 483 0 9 45.0 nan 28 55 86 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAGGGGGAGGAGGTGCTGACGGACTCACCTTT
612 41 8.72472e-05 TGTGCAGAGACTCGTTCTAACGACTACAAGCTCAGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(545) nan TRAJ20*00(285.8) TRAC*00(256.4) 426 436 459 0 10 50.0 nan 19 46 77 12 39 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGACTCGTTCTAACGACTACAAGCTCAGCTTT
614 38 8.08633e-05 TGTGCAATGAGAGAGAAGAGGGAAAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(463.1) nan TRAJ26*00(273.7) TRAC*00(192.6) 432 447 469 0 15 75.0 nan 20 49 80 19 48 ST24A 129.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGAAGAGGGAAAACTATGGTCAGAATTTTGTCTTT
616 37 7.87353e-05 TGTGCTGTGGGGGATTTGGGGTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(461) nan TRAJ48*00(266.2) TRAC*00(211.7) 426 435 462 0 9 45.0 nan 28 52 83 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGGGGATTTGGGGTTTGGAAATGAGAAATTAACCTTT
619 36 7.66073e-05 TGTGCTACGGACGGGGGAGGAAAGCTTATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(597) nan TRAJ23*00(246.6) TRAC*00(311.4) 423 436 456 0 13 65.0 nan 33 52 83 14 33 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACGGGGGAGGAAAGCTTATCTTC
620 36 7.66073e-05 TGTGCTACGGAGCTGGTCTTT NNNNNNNNNNNNNNNNNNNNN TRAV17*00(168.4) nan TRAJ57*00(196) TRAC*00(173.7) 423 434 456 0 11 55.0 nan 41 52 83 10 21 55.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGAGCTGGTCTTT
622 34 7.23514e-05 TGTGCTGTGAGAGACCTGAAAGCTGCAGGCAACAAGCTAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(467.5) nan TRAJ17*00(281.2) TRAC*00(264.6) 426 441 462 0 15 75.0 nan 25 52 83 18 45 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACCTGAAAGCTGCAGGCAACAAGCTAACTTTT
623 34 7.23514e-05 TGTGCTACTCCCCTCAGGGGTTACCAGAAAGTTACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(602.4) nan TRAJ13*00(234) TRAC*00(240.3) 423 431 456 0 8 40.0 nan 29 52 83 16 39 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACTCCCCTCAGGGGTTACCAGAAAGTTACCTTT
624 34 7.23514e-05 TGTGCCGTGAATGCGGCGGGATACAGCACCCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-1*00(518) nan TRAJ11*00(249.9) TRAC*00(232.9) 426 441 460 0 15 75.0 nan 28 49 80 18 39 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAATGCGGCGGGATACAGCACCCTCACCTTT
625 33 7.02234e-05 TGTGCTGTTCATAGGTTTTCAGATGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV1-2*00(306.8) nan TRAJ16*00(292.9) TRAC*00(297.9) 411 419 445 0 8 40.0 nan 20 49 80 13 42 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTTCATAGGTTTTCAGATGGCCAGAAGCTGCTCTTT
626 33 7.02234e-05 TGTGCAGCTCGGGAGGAAGACACAGGCTTTCAGAAACTTGTATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(437.5) nan TRAJ8*00(262.6) TRAC*00(304) 423 431 456 0 8 40.0 nan 23 49 80 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCTCGGGAGGAAGACACAGGCTTTCAGAAACTTGTATTT
628 29 6.17115e-05 TGTGCAGCAAGTGTTAATGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(542.7) nan TRAJ31*00(228) TRAC*00(253.2) 444 455 477 0 11 55.0 nan 28 46 77 15 33 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTGTTAATGCCAGACTCATGTTT
632 27 5.74555e-05 TGTGCTGTGGAGGATAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV2*00(139.4) nan TRAJ26*00(288.8) TRAC*00(229.9) 423 438 457 0 15 75.0 nan 21 49 80 11 39 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAGGATAACTATGGTCAGAATTTTGTCTTT
633 26 5.53275e-05 TGTGCTCTAATGGGGTGGAGGCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV16*00(93.1) nan TRAJ15*00(261.7) TRAC*00(253.2) 414 424 448 0 10 50.0 nan 25 49 80 21 45 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAATGGGGTGGAGGCAGGCAGGAACTGCTCTGATCTTT
634 25 5.31995e-05 TGTGCTGTGAGCCCCTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-4*00(538.6) nan TRAJ48*00(271.9) TRAC*00(320.9) 426 437 460 0 11 55.0 nan 27 52 83 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGCCCCTTTGGAAATGAGAAATTAACCTTT
637 24 5.10715e-05 TGTGCAATGAGAGAGAGGGGCAATGACATGCGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(94) nan TRAJ43*00(232.3) TRAC*00(249.3) 432 447 469 0 15 75.0 nan 27 43 74 20 36 80.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGAGGGGCAATGACATGCGCTTT
638 23 4.89436e-05 TGTGCCGTGAGTATACTCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(503.8) nan TRAJ10*00(317.4) TRAC*00(269.9) 429 439 462 0 10 50.0 nan 19 53 84 11 45 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAGTATACTCACGGGAGGAGGAAACAAACTCACCTTT
639 23 4.89436e-05 TGTGCCGTGAACATACCCACGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(568.8) nan TRAJ10*00(300.9) TRAC*00(283.3) 429 443 462 0 14 70.0 nan 20 53 84 12 45 ST24C 149.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACATACCCACGGGAGGAGGAAACAAACTCACCTTT
641 22 4.68156e-05 TGTGCTCTGAGTGAGGCGGTTGAGGACACACCTCTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(616.1) nan TRAJ29*00(237.7) TRAC*00(306.8) 432 450 469 0 18 90.0 nan 32 49 80 25 42 85.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGGCGGTTGAGGACACACCTCTTGTCTTT
642 20 4.25596e-05 TGTGTGTGACTGGGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-1*00(655.2) nan TRAJ12*00(275.2) TRAC*00(249) 423 429 456 0 6 30.0 nan 24 49 80 13 38 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGTGACTGGGGATAGCAGCTATAAATTGATCTTC
643 20 4.25596e-05 TGTGCTCTAGAGCGGGGCTCAACTGGCTCCTACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV16*00(90) nan TRAJ3*00(289.2) TRAC*00(257) 414 423 448 0 9 45.0 nan 24 51 82 30 57 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTAGAGCGGGGCTCAACTGGCTCCTACAGCAGTGCTTCCAAGATAATCTTT
646 19 4.04316e-05 TGTGCTCTGAGTGGGACGAATTATGGTGGTGCTACAAACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(507.3) nan TRAJ32*00(316) TRAC*00(248.7) 432 445 469 0 13 65.0 nan 21 55 86 17 51 170.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGGGACGAATTATGGTGGTGCTACAAACAAGCTCATCTTT
649 18 3.83037e-05 TGTGCTGTGAGAGACCCCTTGGGGAACAACAGACTCGCTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(594.6) nan TRAJ7*00(247.7) TRAC*00(261.7) 426 441 462 0 15 75.0 nan 27 48 79 21 42 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGACCCCTTGGGGAACAACAGACTCGCTTTT
650 18 3.83037e-05 TGTGCAGAGAATCCCGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-2*00(669.6) nan TRAJ16*00(240.2) TRAC*00(246) 426 438 459 0 12 60.0 nan 31 49 80 15 33 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGAATCCCGGCCAGAAGCTGCTCTTT
651 17 3.61757e-05 TGTGCCGTGAACCTTAGGACTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(451.2) nan TRAJ4*00(267.5) TRAC*00(289.6) 429 441 462 0 12 60.0 nan 26 52 83 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACCTTAGGACTGGTGGCTACAATAAGCTGATTTTT
652 17 3.61757e-05 TGTGCAGAGGATAATGCAGGCAACATGCTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV5*00(569.6) nan TRAJ39*00(276.5) TRAC*00(275) 426 435 459 0 9 45.0 nan 26 52 83 10 36 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGGATAATGCAGGCAACATGCTCACCTTT
654 17 3.61757e-05 CGTGCAGCAAGCGGAGATGACATGCGCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(148.9) nan TRAJ43*00(200.9) TRAC*00(218.5) 444 457 477 0 13 ST444C 49.0 nan 29 43 74 16 30 70.0 nan nan nan nan nan nan nan nan nan nan nan CGTGCAGCAAGCGGAGATGACATGCGCTTT
655 16 3.40477e-05 TGTGCTGTGGAGTATAGTGCCAGACTCATGTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV22*00(600.5) nan TRAJ31*00(230.7) TRAC*00(248.9) 417 429 450 0 12 60.0 nan 30 46 77 17 33 80.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAGTATAGTGCCAGACTCATGTTT
656 16 3.40477e-05 TGTGCCGTGAACGTTGGCCAGAAGCTGCTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV12-2*00(544.9) nan TRAJ16*00(239) TRAC*00(243.6) 429 441 462 0 12 60.0 nan 30 49 80 14 33 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGAACGTTGGCCAGAAGCTGCTCTTT
657 16 3.40477e-05 TGTGCAGCAAGTAGGGACCCGACCGGGAACCAGTTCTATTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV13-1*00(448.3) nan TRAJ49*00(242.1) TRAC*00(315.8) 423 436 456 0 13 65.0 nan 24 45 76 21 42 ST29G 89.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGTAGGGACCCGACCGGGAACCAGTTCTATTTT
658 16 3.40477e-05 TGTGCAGCAAAGGGCGACAGAGATGACAAGATCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV29DV5*00(443.3) nan TRAJ30*00(254.4) TRAC*00(274.9) 444 454 477 0 10 50.0 nan 23 46 77 16 39 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAAGGGCGACAGAGATGACAAGATCATCTTT
659 15 3.19197e-05 TGTGCTTCTTATAACTATGGTCAGAATTTTGTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(480.3) nan TRAJ26*00(268.7) TRAC*00(247.1) 426 432 462 0 6 30.0 nan 23 49 80 10 36 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTCTTATAACTATGGTCAGAATTTTGTCTTT
660 15 3.19197e-05 TGTGCTCTGAATATCTATAACACCGACAAGCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV19*00(129.6) nan TRAJ34*00(269.9) TRAC*00(254.9) 432 442 469 0 10 50.0 nan 23 47 78 15 39 120.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAATATCTATAACACCGACAAGCTCATCTTT
663 15 3.19197e-05 TGTGCAGCAAGCGCGATCAAAACCAGTGGCTCTAGGTTGACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNN TRAV29DV5*00(179) nan TRAJ58*00(256.5) TRAC*00(242) 444 459 477 0 15 75.0 nan 26 52 83 19 45 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGCGATCAAAACCAGTGGCTCTAGGTTGACCTTT
665 14 2.97917e-05 TGTGCTGTGAGAGTCCCCTAGGTGGGAGGCTTCAAAACTATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV3*00(458.8) nan TRAJ9*00(249.9) TRAC*00(275.4) 426 439 462 0 13 65.0 nan 29 50 81 24 45 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGAGTCCCCTAGGTGGGAGGCTTCAAAACTATCTTT
666 14 2.97917e-05 TGTGCAACTGGGGCAAACAACCTCTTCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(621.5) nan TRAJ36*00(275.1) TRAC*00(194.6) 432 439 469 0 7 35.0 nan 23 48 79 5 30 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAACTGGGGCAAACAACCTCTTCTTT
667 13 2.76638e-05 TGTGCTACGGATAATGCTGGCAACAACCGTAAGCTGATTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV17*00(625.6) nan TRAJ38*00(308.8) TRAC*00(142.9) 423 434 456 0 11 55.0 nan 19 51 82 10 42 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGATAATGCTGGCAACAACCGTAAGCTGATTTGG
668 12 2.55358e-05 TGTGCTGTGGGTGACGAGGGAGGAGGAAACAAACTCACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-3*00(633.2) nan TRAJ10*00(274.7) TRAC*00(226.5) 426 439 460 0 13 65.0 nan 28 53 84 17 42 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGGTGACGAGGGAGGAGGAAACAAACTCACCTTT
670 11 2.34078e-05 TGTGCCTTTAACCCTAACTTTGGAAATGAGAAATTAACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV24*00(366.1) nan TRAJ48*00(300) TRAC*00(120) 432 442 462 0 10 50.0 nan 23 52 83 13 42 145.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCTTTAACCCTAACTTTGGAAATGAGAAATTAACCTTT
673 10 2.12798e-05 TGTGCTCCATCCCCCAAGGGAACCCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV16*00(80) nan TRAJ15*00(278) TRAC*00(246) 414 421 448 0 7 35.0 nan 24 49 80 23 48 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCCATCCCCCAAGGGAACCCAGGCAGGAACTGCTCTGATCTTT
674 10 2.12798e-05 TGCGGCACAGAGTTCAACCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV30*00(593.3) nan TRAJ15*00(292.4) TRAC*00(269.4) 423 435 456 0 12 60.0 nan 21 49 80 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGCGGCACAGAGTTCAACCAGGCAGGAACTGCTCTGATCTTT
680 6 1.27679e-05 TGTGCTTCCGCGGACAATAACAATGACATGCGCTTT EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE TRAV36DV7*00(644.8) nan TRAJ43*00(267.3) TRAC*00(203.7) 426 432 459 0 6 30.0 nan 20 43 74 13 36 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTCCGCGGACAATAACAATGACATGCGCTTT
686 6 1.27679e-05 TGCATCGTCAGAGTCGACGGGGCAACTGACAGCTGGGGGAAATTCCAGTTT NNNNJNNNNNNNNNNNNNNNNNNNNNNNNNNNNNJNNNNNNNNNNNNNNNN TRAV26-1*00(377.4) nan TRAJ24*00(276) TRAC*00(273.8) 411 427 447 0 16 80.0 nan 23 52 83 22 51 SG45C 129.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCGTCAGAGTCGACGGGGCAACTGACAGCTGGGGGAAATTCCAGTTT
687 5 1.06399e-05 TGTGCTTATAGGAGCTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV38-2DV8*00(529.4) nan TRAJ42*00(305) TRAC*00(120) 432 447 468 0 15 75.0 nan 25 55 86 15 45 150.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTTATAGGAGCTATGGAGGAAGCCAAGGAAATCTCATCTTT
688 5 1.06399e-05 TGTGCTCTTCCGTCGGCCAACCAGGCAGGAACTGCTCTGATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV6*00(96) nan TRAJ15*00(294) TRAC*00(138) 426 434 459 0 8 40.0 nan 18 49 80 14 45 155.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTTCCGTCGGCCAACCAGGCAGGAACTGCTCTGATCTTT
690 4 8.51192e-06 TGTGTGGTGATACCTGGTGGCTACAATAAGCTGATTTTT NNNNNNNNNNNNNNDNNNNNNNNHNNNNNNNNNNNNNNN TRAV12-1*00(557.7) nan TRAJ4*00(276.3) TRAC*00(253.3) 423 433 456 0 10 50.0 nan 26 52 83 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGTGATACCTGGTGGCTACAATAAGCTGATTTTT
691 4 8.51192e-06 TGTGCTCTGAGTGAGCCCTTTTCAGATGGCCAGAAGCTGCTCTTT NNEJNNNNNNNJNENNNNNNNEJNNNNNNNENNNNNNENNNJNJN TRAV19*00(625.8) nan TRAJ16*00(258) TRAC*00(230) 432 447 469 0 15 75.0 nan 22 49 80 18 45 135.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTGAGTGAGCCCTTTTCAGATGGCCAGAAGCTGCTCTTT
692 4 8.51192e-06 TGTGCTGTGAATCTGGATAGCAGCTATAAATTGATCTTC NN>NNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV21*00(543.3) nan TRAJ12*00(277) TRAC*00(316) 423 433 455 0 10 50.0 nan 23 49 80 13 39 130.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAATCTGGATAGCAGCTATAAATTGATCTTC
698 3 6.38394e-06 TGTGCTCTTTACCTTTGGAAATGAGAAATTAACCTTT NNNNNNNANNNNNNNENNNJNNNNNNNNNNNNNNNNN TRAV16*00(614.3) nan TRAJ48*00(272) TRAC*00(276.5) 414 422 448 0 8 40.0 nan 27 52 83 12 37 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTTTACCTTTGGAAATGAGAAATTAACCTTT
703 3 6.38394e-06 TGTGCAGGAGCTCCGGATAGCAACTATCAGTTAATCTGG NNNNNNNNNNNDNNNNNNNNNNNNNNNNNNNNNNNNDAN TRAV27*00(543) nan TRAJ33*00(264) TRAC*00(330) 417 431 447 0 14 70.0 nan 21 46 77 14 39 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGAGCTCCGGATAGCAACTATCAGTTAATCTGG
704 3 6.38394e-06 TGTGCAGAGCGACGAGGCTACAATAAGCTGATTTTT EEEEEEEEAEEEEEEAE<EEEEEEEEEEEEEEEEEE TRAV5*00(713) nan TRAJ4*00(260) TRAC*00(250) 426 435 459 0 9 45.0 nan 31 52 83 15 36 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGAGCGACGAGGCTACAATAAGCTGATTTTT
705 3 6.38394e-06 TGTGCAATGAGTATGATGGATAGCAGCTATAAATTGATCTTC NNNNNNNNNNNNNNNENNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(503.5) nan TRAJ12*00(295) TRAC*00(285) 432 443 469 0 11 55.0 nan 21 49 80 14 42 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGTATGATGGATAGCAGCTATAAATTGATCTTC
706 3 6.38394e-06 TGTGCAATGAGAGAGCCAACGTACAGCAGTGCTTCCAAGATAATCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV14DV4*00(735.7) nan TRAJ3*00(295) TRAC*00(108.7) 432 447 469 0 15 75.0 nan 23 51 82 20 48 140.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGCCAACGTACAGCAGTGCTTCCAAGATAATCTTT
707 3 6.38394e-06 TGTGCAATGAGAGAGGGCCGAGCTGGGGCAAACAACCTCTTCTTT NNNNNNNNNNNNNNNNNNNNNNNNDNNNNNNNNNNNNNNNNHNNN TRAV14DV4*00(550) nan TRAJ36*00(243.7) TRAC*00(244.7) 432 451 469 0 19 95.0 nan 25 48 79 22 45 115.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGAGAGGGCCGAGCTGGGGCAAACAACCTCTTCTTT
709 3 6.38394e-06 CGGACGAACCAGGCAGGAACTGCTCTGATCTTT EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE TRAV12-2*00(481) nan TRAJ15*00(284.7) TRAC*00(250) 429 429 462 0 0 0.0 nan 22 49 80 6 33 135.0 nan nan nan nan nan nan nan nan nan nan nan CGGACGAACCAGGCAGGAACTGCTCTGATCTTT
710 2 4.25596e-06 TGTGCTGTGGAAGGATACAGCACCCTCACCTTT EEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEE TRAV22*00(681.5) nan TRAJ11*00(265) TRAC*00(250) 417 428 450 0 11 55.0 nan 27 49 80 11 33 110.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAAGGATACAGCACCCTCACCTTT
711 2 4.25596e-06 TGTGCTGTGAGCCTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTT NNNNJNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TRAV8-6*00(614) nan TRAJ42*00(330) TRAC*00(242) 426 437 460 0 11 55.0 nan 20 55 86 13 48 175.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGAGCCTGAATTATGGAGGAAGCCAAGGAAATCTCATCTTT
715 2 4.25596e-06 TGTGCAGCAAGCGGAGATGACATGCGCTTT EEEEEEEEEEEEEEEEEEEEEEEEAEEAEE TRAV29DV5*00(165) nan TRAJ43*00(225) TRAC*00(250) 444 457 477 0 13 65.0 nan 29 43 74 16 30 70.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCAAGCGGAGATGACATGCGCTTT
716 2 4.25596e-06 TGTGCAGGGCCTTTT NNNNNNNKNNNNNNN TRAV25*00(380) nan TRAJ43*00(170) TRAC*00(320) 417 428 446 0 11 55.0 nan 40 43 74 12 15 15.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGGGCCTTTT
718 1 2.12798e-06 TGTGTGGGGAGCCAGTGGGGAAAGCTTTGGGAATGTGCTGCATGC EAEAE<<AE<EEEEAEEEAEEEEEEEEA<AEAAAEEEEEAAEE<E TRAV10*00(587) nan TRAJ35*00(228) TRAC*00(250) 429 441 462 0 12 ST436G 44.0 nan 25 48 79 23 45 DT45 89.0 nan nan nan nan nan nan nan nan nan nan nan TGTGTGGGGAGCCAGTGGGGAAAGCTTTGGGAATGTGCTGCATGC
719 1 2.12798e-06 TGTGCTCTATTCACGGGCAGGAGAGCACTTACTTTT <6EAEEEEEEAEEAA<EEEEEEEEEEAEEEEEEEEE TRAV6*00(643) nan TRAJ5*00(280) TRAC*00(250) 426 435 459 0 9 45.0 nan 24 49 80 11 36 125.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTCTATTCACGGGCAGGAGAGCACTTACTTTT
720 1 2.12798e-06 TGTGCTGTGGAGCAGAGCGGTAACCAGTTCTATTTT EEEEEEEEEEEAEEEEEEA<EEEEEEEEEEEEEEEE TRAV22*00(770) nan TRAJ49*00(250) TRAC*00(250) 417 430 450 0 13 65.0 nan 26 45 76 17 36 95.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTGTGGAGCAGAGCGGTAACCAGTTCTATTTT
723 1 2.12798e-06 TGTGCTACGGACTATGGGGTCAAGGTGATATTT EEEEAEAE<EEEEAEEEEEEEEE<EEAEEEEEE TRAV17*00(620) nan TRAJ50*00(220) TRAC*00(250) 423 435 456 0 12 60.0 nan 36 49 80 20 33 65.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCTACGGACTATGGGGTCAAGGTGATATTT
724 1 2.12798e-06 TGTGCCGTGACGAACGACTACAAGCTCAGCTTT EEEEAEEEEEEEEEEEEEEEEEEAAEEEAEEAE TRAV12-2*00(748) nan TRAJ20*00(244) TRAC*00(234) 429 439 462 0 10 50.0 nan 25 46 77 12 33 105.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCCGTGACGAACGACTACAAGCTCAGCTTT
741 1 2.12798e-06 TGTGCAGCCCGTGAGGAGAGCACTTACTTTT EEAEEEAEEEEEEEEEEEEEEEEEEEEEEEE TRAV13-1*00(519) nan TRAJ5*00(245) TRAC*00(250) 423 431 456 0 8 40.0 nan 31 49 80 13 31 90.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAGCCCGTGAGGAGAGCACTTACTTTT
742 1 2.12798e-06 TGTGCAATGAGCGATCCGGATAGTGGAGGTAGCAACTATAAACTGACATTT EEE<EEAEEAEEEEAEEAAAEEEEE<EEAEEEEEEEEEEEEEEEEEEEEEE TRAV12-3*00(249) nan TRAJ53*00(315) TRAC*00(104) 429 442 462 0 13 65.0 nan 23 55 86 19 51 160.0 nan nan nan nan nan nan nan nan nan nan nan TGTGCAATGAGCGATCCGGATAGTGGAGGTAGCAACTATAAACTGACATTT
743 1 2.12798e-06 TGCGCTGTGAGAGACGATAACAATGCCAGACTCATGTTT AEE<EEEA66EEA<<<EEEEEEEEAEAEEEEEEEAEEEE TRAV1-1*00(618) nan TRAJ31*00(254) TRAC*00(250) 411 425 445 0 14 70.0 nan 23 46 77 16 39 115.0 nan nan nan nan nan nan nan nan nan nan nan TGCGCTGTGAGAGACGATAACAATGCCAGACTCATGTTT
746 1 2.12798e-06 TGCATCCTGAGAGGACGCAACAATGACATGCGCTTT AEEE<EEEAAEEAEEEEEEEEEEEEAEEEAAEEEEE TRAV26-2*00(738) nan TRAJ43*00(245) TRAC*00(250) 411 424 446 0 13 65.0 nan 25 43 74 18 36 90.0 nan nan nan nan nan nan nan nan nan nan nan TGCATCCTGAGAGGACGCAACAATGACATGCGCTTT

Quality controls

MiXCR generates comprehensive reports for each step of the pipeline, containing exhaustive information about quality of the library and performance of the algorithms. These reports are a primary source of the feedback to the wet lab, and also may be used to tune the parameters of the pipeline.

The very basic overview of the library performance may be generated in a graphical form using mixcr exportQc align command:

mixcr exportQc align results/*.clns figs/alignQc.pdf
alignQc.svg

This plot shows the fraction of raw reads that were successfully aligned against reference V/D/J/C-gene segment library. Rate of successful alignments is expected to be higher than 90% for a high quality targeted TCR library. So in the considered example something went not as expected.

In most cases when we observe low alignment rate for amplicon library, the reason lies either in a wrong understanding of the library architecture or some sample preparation artefacts. From the plot we see two primary reasons for failed alignments:

  • Alignment failed, no any hits (not TCR/IG) - read was not covered by any part of V/D/J/C-gene segments, which is probably due to a contamination in the lab
  • Alignments failed because of absence of J hits - read was covered by V segment, but not by J

To dig deeper one can re-align one problematic sample with the options to preserve partial alignments and save not-aligned reads:

mkdir -p debug
mixcr align -f \
    --species hsa \
    --tag-pattern '^(R1:*)\^(UMI:N{12})' \
    -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \
    -OvParameters.parameters.floatingLeftBound=true \
    -OjParameters.parameters.floatingRightBound=false \
    -OcParameters.parameters.floatingRightBound=true \
    -OallowNoCDR3PartAlignments=true \
    -OallowPartialAlignments=true \
    --not-aligned-R1 debug/na.fastq \
    raw/SRR{{n}}_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_1.fastq.gz \
    raw/SRR{{n}}_GSM4195532_TCR-seq_P23-T0-DPOS_Homo_sapiens_OTHER_2.fastq.gz \
    debug/P23-T0-DPOS_debug.vdjca

Additional options are:

-OallowNoCDR3PartAlignments
preserve alignments that do not fully cover CDR3 region in the output
-OallowPartialAlignments
preserve alignments that lack either V or J hit in the output
--not-aligned-R1
save all not aligned reads to na.fastq

Now one can check how reads cover V-D-J region using exportQc coverage command:

mixcr exportQc coverage \
      debug/P23-T0-DPOS_debug.vdjca \
      figs/P23-T0-DPOS_debug.coverage.pdf
coverage

From this plot it is seen that there are nearly 50% of not-spliced reads in the data, which is a clear signal of some library preparation artefacts.

To dig even deeper one can also export raw alignments in a human-readable way for further manual inspection:

mixcr exportAlignmentsPretty debug/P23-T0-DPOS_debug.vdjca

Some examples from the output illustrating wet lab artefacts:

>>> Read ids: 1

   Quality    22222224225262622222222727222
   Target0  0 CATAAAATCATCGTGTCAGAGAAGGGAAA 28   Score
TRBV7-2*00 94                 cagagaagggaaa 106  65
TRBV7-3*00 94                 cagagaagggaaa 106  65


          _ T  P  H  P  P  P  H  P  A  A  P  D  P  P  P  P  T  P  P  L  H  P  P  P  P  P
Quality   26222554266244522552226622622255252424222424522222224572655225265422265622726222
Target1 0 CACACCCCACCCCCCCCCCCACCCCGCCGCCCCCGACCCCCCTCCCCCGACCCCCCCCCTCCACCCCCCCCCCCCCCCCC 79  Score

                                                                                     <J     CD
              P  H  P  P  P  P  P  P  H  A  P  P  P  P  P  P  P  P  P  R  A  G  R  H  T  Q  Y
   Quality    56264672227222227277727225222242256272762722222226222262222222222222222767777752
   Target1 80 CCCACCCCCCCCCCCCCCCCCCCCACGCGCCCCCCCCCCCCCCCCCCCCCCCCCCCCGCGCCGGCCGCCACACCCAGTAC 159  Score
TRBJ2-5*00 28                                                                        acccagtac 36   186

               R3><FR4                    FR4><C
                F  G  P  G  T  R  L  L  V  L  E  D  L  K  N  V  F  P  P  E  V  A  V  F  E  P  S
   Quality     77462776776777222727275627625777775676777777767777772727666777767577676777777777
   Target1 160 TTCGGGCCAGGCACGCGGCTACTGGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATC 239  Score
TRBJ2-5*00  37 ttcgggccaggcacgcggctCctggtgctcg                                                  67   186
  TRBC2*00   0                                aggacctgaaaaacgtgttcccacccgaggtcgctgtgtttgagccatc 48   330
  TRBC1*00   0                                aggacctgaaCaaGgtgttcccacccgaggtcgctgtgtttgagccatc 48   302


>>> Read ids: 17

Quality   22222222222777777727776774777
Target0 0 ACTAGAGGTGGTCTTAATAACATCAGGGA 28  Score


             _ E  S  I  I  R  Q  L  Y  S  L  L  I  T  S  G  K  S  L  K  F  I  L  E  N  L  I
 Quality     24624425222562545262542222265255252255252252467657526665566526226544775226266625
 Target1   0 TGAGAGCATAATTAGACAATTGTATTCCTTATTAATAACATCAGGGAAAAGCCTTAAATTTATACTGGAAAATCTAATTG 79   Score
TRGV8*00 274                                          cagggaaGagccttaaatttatactggaaaatctaattg 312  356

                                 FR3><CDR3     V>         <J               CDR3><FR4
              E  R  D  S  G  V  Y  Y  C  A  T  W  I  Q  G _ T  G  W  F  K  I  F  A  E  G  T  K
  Quality     66446666665444255226265657272527756756665255757525576277277777766767777777677777
  Target1  80 AACGTGACTCTGGGGTCTATTACTGTGCCACCTGGATTCAGGGGCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAA 159  Score
 TRGV8*00 313 aacgtgactctggggtctattactgtgccacctgg                                              347  356
TRGJP1*00  24                                             cactggttggttcaagatatttgctgaagggactaa 59   280

                              FR4><C
                L  I  V  T  S  P  D  K  Q  L  D  A  D  V  S  P  K  P  T  I  F  L  P  S  I  A
  Quality     77777777777577776777777777777776767777776677777677777777777777777777767777777777
  Target1 160 GCTCATAGTAACTTCACCTGATAAACAACTTGATGCAGATGTTTCCCCCAAGCCCACTATTTTTCTTCCTTCAATTGCTG 239  Score
TRGJP1*00  60 gctcatagtaacttcacctg                                                             79   280
 TRGC1*00   0                     ataaacaacttgatgcagatgtttcccccaagcccactatttttcttccttcaattgctg 59   391
 TRGC2*00   0                     ataaacaacttgatgcagatgtttcccccaagcccactatttttcttccttcaattgctg 59   377

Finally, one can use na.fastq to blast not aligned sequences and precisely determine the source of not aligned reads: contamination, artefacts in the library preparation etc.

Another useful report is a chain usage report:

mixcr exportQc chainUsage results/*.clns figs/chainUsage.pdf
chainUsage.svg

Here we see a small fraction of TRG sequences, which are not supposed to be present in the library, thus the initial cell selection probably was not ideal.

Individual reports generated at each step of MiXCR pipeline can be exported either in JSON or text form using exportReports command:

mixcr exportReports \
      --json \
      results/P15-T0-TIGIT.clns \
      results/P15-T0-TIGIT.report.json

Detailed description of each report can be found in reports section of reference.

Downstream analysis

There are two types of basic downstream analysis: individual and overlap. Individual computes CDR3 metrics, diversity and gene usage metrics for each dataset. Overlap computes statistical metrics of repertoire overlap. In both cases MiXCR applies appropriate sample normalization.

To run postanalysis routines we need to prepare a metadata file in a .tsv or .csv form. Table must contain sample column which will be used to match metadata with cloneset files. For our project metadata table looks like:

Sample Patient Time Marker
P14-M1-DNEG P14 M1 DNEG
P14-M1-DPOS P14 M1 DPOS
P14-M1-PD1 P14 M1 PD1
See full metadata:
Sample Patient Time Marker
P14-M1-DNEG P14 M1 DNEG
P14-M1-DPOS P14 M1 DPOS
P14-M1-PD1 P14 M1 PD1
P14-M1-TIGIT P14 M1 TIGIT
P14-M2-DNEG P14 M2 DNEG
P14-M2-DPOS P14 M2 DPOS
P14-M2-PD1 P14 M2 PD1
P14-M2-TIGIT P14 M2 TIGIT
P14-T0-DNEG P14 T0 DNEG
P14-T0-DPOS P14 T0 DPOS
P14-T0-PD1 P14 T0 PD1
P14-T0-TIGIT P14 T0 TIGIT
P15-M1-DNEG P15 M1 DNEG
P15-M1-DPOS P15 M1 DPOS
P15-M1-PD1 P15 M1 PD1
P15-M1-TIGIT P15 M1 TIGIT
P15-M2-DNEG P15 M2 DNEG
P15-M2-DPOS P15 M2 DPOS
P15-M2-PD1 P15 M2 PD1
P15-M2-TIGIT P15 M2 TIGIT
P15-T0-DNEG P15 T0 DNEG
P15-T0-DPOS P15 T0 DPOS
P15-T0-PD1 P15 T0 PD1
P15-T0-TIGIT P15 T0 TIGIT
P16-M1-DNEG P16 M1 DNEG
P16-M1-DPOS P16 M1 DPOS
P16-M1-PD1 P16 M1 PD1
P16-M1-TIGIT P16 M1 TIGIT
P16-M2-DNEG P16 M2 DNEG
P16-M2-DPOS P16 M2 DPOS
P16-M2-PD1 P16 M2 PD1
P16-M2-TIGIT P16 M2 TIGIT
P16-T0-DNEG P16 T0 DNEG
P16-T0-DPOS P16 T0 DPOS
P16-T0-PD1 P16 T0 PD1
P16-T0-TIGIT P16 T0 TIGIT
P18-M1-DNEG P18 M1 DNEG
P18-M1-DPOS P18 M1 DPOS
P18-M1-PD1 P18 M1 PD1
P18-M1-TIGIT P18 M1 TIGIT
P18-M2-DNEG P18 M2 DNEG
P18-M2-DPOS P18 M2 DPOS
P18-M2-PD1 P18 M2 PD1
P18-M2-TIGIT P18 M2 TIGIT
P18-T0-DNEG P18 T0 DNEG
P18-T0-DPOS P18 T0 DPOS
P18-T0-PD1 P18 T0 PD1
P18-T0-TIGIT P18 T0 TIGIT
P19-M1-DNEG P19 M1 DNEG
P19-M1-DPOS P19 M1 DPOS
P19-M1-PD1 P19 M1 PD1
P19-M1-TIGIT P19 M1 TIGIT
P19-M2-DNEG P19 M2 DNEG
P19-M2-DPOS P19 M2 DPOS
P19-M2-PD1 P19 M2 PD1
P19-M2-TIGIT P19 M2 TIGIT
P19-T0-DNEG P19 T0 DNEG
P19-T0-DPOS P19 T0 DPOS
P19-T0-PD1 P19 T0 PD1
P19-T0-TIGIT P19 T0 TIGIT
P21-M1-DNEG P21 M1 DNEG
P21-M1-DPOS P21 M1 DPOS
P21-M1-PD1 P21 M1 PD1
P21-M1-TIGIT P21 M1 TIGIT
P21-M2-DNEG P21 M2 DNEG
P21-M2-DPOS P21 M2 DPOS
P21-M2-PD1 P21 M2 PD1
P21-M2-TIGIT P21 M2 TIGIT
P21-T0-DNEG P21 T0 DNEG
P21-T0-DPOS P21 T0 DPOS
P21-T0-PD1 P21 T0 PD1
P21-T0-TIGIT P21 T0 TIGIT
P22-M1-DNEG P22 M1 DNEG
P22-M1-DPOS P22 M1 DPOS
P22-M1-PD1 P22 M1 PD1
P22-M1-TIGIT P22 M1 TIGIT
P22-M2-DNEG P22 M2 DNEG
P22-M2-DPOS P22 M2 DPOS
P22-M2-PD1 P22 M2 PD1
P22-M2-TIGIT P22 M2 TIGIT
P22-T0-DNEG P22 T0 DNEG
P22-T0-DPOS P22 T0 DPOS
P22-T0-PD1 P22 T0 PD1
P22-T0-TIGIT P22 T0 TIGIT
P23-M1-DNEG P23 M1 DNEG
P23-M1-DPOS P23 M1 DPOS
P23-M1-PD1 P23 M1 PD1
P23-M1-TIGIT P23 M1 TIGIT
P23-T0-DNEG P23 T0 DNEG
P23-T0-DPOS P23 T0 DPOS
P23-T0-PD1 P23 T0 PD1
P23-T0-TIGIT P23 T0 TIGIT
P5-M1-DNEG P5 M1 DNEG
P5-M1-DPOS P5 M1 DPOS
P5-M1-PD1 P5 M1 PD1
P5-M1-TIGIT P5 M1 TIGIT
P5-M2-DNEG P5 M2 DNEG
P5-M2-DPOS P5 M2 DPOS
P5-M2-PD1 P5 M2 PD1
P5-M2-TIGIT P5 M2 TIGIT
P5-T0-DNEG P5 T0 DNEG
P5-T0-DPOS P5 T0 DPOS
P5-T0-PD1 P5 T0 PD1
P5-T0-TIGIT P5 T0 TIGIT
P6-M1-DNEG P6 M1 DNEG
P6-M1-DPOS P6 M1 DPOS
P6-M1-PD1 P6 M1 PD1
P6-M1-TIGIT P6 M1 TIGIT
P6-T0-DNEG P6 T0 DNEG
P6-T0-DPOS P6 T0 DPOS
P6-T0-PD1 P6 T0 PD1
P6-T0-TIGIT P6 T0 TIGIT
P7-M1-DNEG P7 M1 DNEG
P7-M1-DPOS P7 M1 DPOS
P7-M1-PD1 P7 M1 PD1
P7-M1-TIGIT P7 M1 TIGIT
P7-M2-DNEG P7 M2 DNEG
P7-M2-DPOS P7 M2 DPOS
P7-M2-PD1 P7 M2 PD1
P7-M2-TIGIT P7 M2 TIGIT
P7-T0-DNEG P7 T0 DNEG
P7-T0-DPOS P7 T0 DPOS
P7-T0-PD1 P7 T0 PD1
P7-T0-TIGIT P7 T0 TIGIT
P8-M1-DNEG P8 M1 DNEG
P8-M1-DPOS P8 M1 DPOS
P8-M1-PD1 P8 M1 PD1
P8-M1-TIGIT P8 M1 TIGIT
P8-M2-DNEG P8 M2 DNEG
P8-M2-DPOS P8 M2 DPOS
P8-M2-PD1 P8 M2 PD1
P8-M2-TIGIT P8 M2 TIGIT
P8-T0-DNEG P8 T0 DNEG
P8-T0-DPOS P8 T0 DPOS
P8-T0-PD1 P8 T0 PD1
P8-T0-TIGIT P8 T0 TIGIT

Individual metrics

To compute individual metrics of datasets we run

mixcr postanalysis individual -f \
    --metadata metadata.tsv \
    --default-downsampling count-umi-auto \
    --default-weight-function umi \
    --only-productive \
    --tables pa/i.tsv \
    --preproc-tables pa/i.preproc.tsv \
    results/*.clns \
    pa/i.json.gz

The meaning of specified options is the following:

--metadata
specified metadata file to use
--default-downsampling
downsampling applied to normalize the clonesets. Without appropriate normalization it is not possible to make a statistical comparisons between datasets. In the considered case we normalize data to the same number of UMIs, and this number is computed automatically based on the number of unique UMIs in each clone in each dataset. For all downsampling options see [TODO]. Default downsampling may be overridden for individual metrics.
--default-weight-function
defines weight of each clonotype. May be read, umi or cell
--only-productive
drop clonotypes with out-of-frame CDR3 sequences or containing stop codons
--tables
path for postanalysis metrics in a tabular form
--preproc-tables
path for tabular summary of the applied downsampling and other samples preprocessing (for example filtering productive clonotypes)

After execution, we will have the following files:

> ls pa/

# gzipped JSON with all results 
i.json.gz

# summary of applied downsampling
i.preproc.TRA.tsv
i.preproc.TRB.tsv
# diversity tables
i.diversity.TRA.tsv
i.diversity.TRB.tsv
# CDR3 metrics tables & CDR3 properties
i.cdr3metrics.TRA.tsv
i.cdr3metrics.TRB.tsv
# V-gene usage
i.vUsage.TRA.tsv
i.vUsage.TRB.tsv

...

MiXCR runs postanalysis for each chain individually, so we have result per each chain in the output. One can specify --chains option to select specific chains for the analysis. Also in case if you have separate .fastq files for separate chains, it is possible to specify chains metadata column.

Preprocessing summary tables (e.g. i.preproc.TRA.tsv) contain detailed information on how downsampling was applied for each metric:

characteristic sample preprocessor nElementsBefore sumWeightBefore nElementsAfter sumWeightAfter preprocessor#1 nElementsBefore#1 sumWeightBefore#1 nElementsAfter#1 sumWeightAfter#1 preprocessor#2 nElementsBefore#2 sumWeightBefore#2 nElementsAfter#2 sumWeightAfter#2 preprocessor#3 nElementsBefore#3 sumWeightBefore#3 nElementsAfter#3 sumWeightAfter#3 preprocessor#4 nElementsBefore#4 sumWeightBefore#4 nElementsAfter#4 sumWeightAfter#4
VFamilyUsage P14-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 704 9455 215 2016 Filter [TRA] 704 9455 279 3442 Filter stops in CDR3, OOF in CDR3 279 3442 242 3048 Downsample by umi automatic 242 3048 215 2016 nan nan nan
VFamilyUsage P16-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 581 9645 132 2016 Filter [TRA] 581 9645 228 4514 Filter stops in CDR3, OOF in CDR3 228 4514 172 3994 Downsample by umi automatic 172 3994 132 2016 nan nan nan
VFamilyUsage P21-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1076 11773 331 2016 Filter [TRA] 1076 11773 520 5325 Filter stops in CDR3, OOF in CDR3 520 5325 458 4933 Downsample by umi automatic 458 4933 331 2016 nan nan nan
See full preprocessing summary:
characteristic sample preprocessor nElementsBefore sumWeightBefore nElementsAfter sumWeightAfter preprocessor#1 nElementsBefore#1 sumWeightBefore#1 nElementsAfter#1 sumWeightAfter#1 preprocessor#2 nElementsBefore#2 sumWeightBefore#2 nElementsAfter#2 sumWeightAfter#2 preprocessor#3 nElementsBefore#3 sumWeightBefore#3 nElementsAfter#3 sumWeightAfter#3 preprocessor#4 nElementsBefore#4 sumWeightBefore#4 nElementsAfter#4 sumWeightAfter#4
VFamilyUsage P14-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 704 9455 215 2016 Filter [TRA] 704 9455 279 3442 Filter stops in CDR3, OOF in CDR3 279 3442 242 3048 Downsample by umi automatic 242 3048 215 2016 nan nan
VFamilyUsage P16-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 581 9645 132 2016 Filter [TRA] 581 9645 228 4514 Filter stops in CDR3, OOF in CDR3 228 4514 172 3994 Downsample by umi automatic 172 3994 132 2016 nan nan
VFamilyUsage P21-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1076 11773 331 2016 Filter [TRA] 1076 11773 520 5325 Filter stops in CDR3, OOF in CDR3 520 5325 458 4933 Downsample by umi automatic 458 4933 331 2016 nan nan
VFamilyUsage P23-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 80 579 36 180 Filter [TRA] 80 579 40 184 Filter stops in CDR3, OOF in CDR3 40 184 36 180 Downsample by umi automatic 36 180 36 180 nan nan
VFamilyUsage P19-M2PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2090 45179 317 2016 Filter [TRA] 2090 45179 1147 30548 Filter stops in CDR3, OOF in CDR3 1147 30548 987 29429 Downsample by umi automatic 987 29429 317 2016 nan nan
VFamilyUsage P21-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 960 19855 280 2016 Filter [TRA] 960 19855 510 11141 Filter stops in CDR3, OOF in CDR3 510 11141 429 10081 Downsample by umi automatic 429 10081 280 2016 nan nan
VFamilyUsage P5-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 789 31519 167 2016 Filter [TRA] 789 31519 400 17067 Filter stops in CDR3, OOF in CDR3 400 17067 352 15973 Downsample by umi automatic 352 15973 167 2016 nan nan
VFamilyUsage P8-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1209 37998 258 2016 Filter [TRA] 1209 37998 655 21649 Filter stops in CDR3, OOF in CDR3 655 21649 561 20541 Downsample by umi automatic 561 20541 258 2016 nan nan
VFamilyUsage P18-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2066 92011 452 2016 Filter [TRA] 2066 92011 1222 63269 Filter stops in CDR3, OOF in CDR3 1222 63269 1033 59264 Downsample by umi automatic 1033 59264 452 2016 nan nan
VFamilyUsage P16-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 331 10152 75 2016 Filter [TRA] 331 10152 120 4312 Filter stops in CDR3, OOF in CDR3 120 4312 93 3666 Downsample by umi automatic 93 3666 75 2016 nan nan
VFamilyUsage P22-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 258 7836 88 2016 Filter [TRA] 258 7836 124 3923 Filter stops in CDR3, OOF in CDR3 124 3923 99 3177 Downsample by umi automatic 99 3177 88 2016 nan nan
VFamilyUsage P18-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1709 31160 395 2016 Filter [TRA] 1709 31160 964 22048 Filter stops in CDR3, OOF in CDR3 964 22048 848 21055 Downsample by umi automatic 848 21055 395 2016 nan nan
VFamilyUsage P5-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 669 8934 262 2016 Filter [TRA] 669 8934 341 5148 Filter stops in CDR3, OOF in CDR3 341 5148 297 4553 Downsample by umi automatic 297 4553 262 2016 nan nan
VFamilyUsage P22-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1593 50054 301 2016 Filter [TRA] 1593 50054 873 32294 Filter stops in CDR3, OOF in CDR3 873 32294 721 29971 Downsample by umi automatic 721 29971 301 2016 nan nan
VFamilyUsage P16-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 880 15352 249 2016 Filter [TRA] 880 15352 445 6911 Filter stops in CDR3, OOF in CDR3 445 6911 355 6074 Downsample by umi automatic 355 6074 249 2016 nan nan
VFamilyUsage P7-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1720 33563 360 2016 Filter [TRA] 1720 33563 986 22404 Filter stops in CDR3, OOF in CDR3 986 22404 864 20675 Downsample by umi automatic 864 20675 360 2016 nan nan
VFamilyUsage P15-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2401 18323 745 2016 Filter [TRA] 2401 18323 1355 10634 Filter stops in CDR3, OOF in CDR3 1355 10634 1221 9710 Downsample by umi automatic 1221 9710 745 2016 nan nan
VFamilyUsage P16-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1264 20091 360 2016 Filter [TRA] 1264 20091 705 10909 Filter stops in CDR3, OOF in CDR3 705 10909 619 10226 Downsample by umi automatic 619 10226 360 2016 nan nan
VFamilyUsage P15-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2596 15442 829 2016 Filter [TRA] 2596 15442 1406 8725 Filter stops in CDR3, OOF in CDR3 1406 8725 1241 7797 Downsample by umi automatic 1241 7797 829 2016 nan nan
VFamilyUsage P14-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1631 14813 520 2016 Filter [TRA] 1631 14813 909 7948 Filter stops in CDR3, OOF in CDR3 909 7948 795 7429 Downsample by umi automatic 795 7429 520 2016 nan nan
VFamilyUsage P7-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 708 16707 153 2016 Filter [TRA] 708 16707 366 10791 Filter stops in CDR3, OOF in CDR3 366 10791 306 10337 Downsample by umi automatic 306 10337 153 2016 nan nan
VFamilyUsage P7-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3854 40098 549 2016 Filter [TRA] 3854 40098 2133 23481 Filter stops in CDR3, OOF in CDR3 2133 23481 1887 21846 Downsample by umi automatic 1887 21846 549 2016 nan nan
VFamilyUsage P18-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1815 31892 388 2016 Filter [TRA] 1815 31892 1027 20669 Filter stops in CDR3, OOF in CDR3 1027 20669 883 19505 Downsample by umi automatic 883 19505 388 2016 nan nan
VFamilyUsage P15-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 749 15816 239 2016 Filter [TRA] 749 15816 399 10978 Filter stops in CDR3, OOF in CDR3 399 10978 360 10654 Downsample by umi automatic 360 10654 239 2016 nan nan
VFamilyUsage P8-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 836 20403 223 2016 Filter [TRA] 836 20403 416 12545 Filter stops in CDR3, OOF in CDR3 416 12545 359 11838 Downsample by umi automatic 359 11838 223 2016 nan nan
VFamilyUsage P19-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2532 67648 333 2016 Filter [TRA] 2532 67648 1394 40352 Filter stops in CDR3, OOF in CDR3 1394 40352 1174 37896 Downsample by umi automatic 1174 37896 333 2016 nan nan
VFamilyUsage P14-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1202 15201 294 2016 Filter [TRA] 1202 15201 516 6933 Filter stops in CDR3, OOF in CDR3 516 6933 402 5790 Downsample by umi automatic 402 5790 294 2016 nan nan
VFamilyUsage P5-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2745 24504 633 2016 Filter [TRA] 2745 24504 1393 12912 Filter stops in CDR3, OOF in CDR3 1393 12912 1264 12134 Downsample by umi automatic 1264 12134 633 2016 nan nan
VFamilyUsage P22-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2380 53898 491 2016 Filter [TRA] 2380 53898 1294 31762 Filter stops in CDR3, OOF in CDR3 1294 31762 1099 29827 Downsample by umi automatic 1099 29827 491 2016 nan nan
VFamilyUsage P21-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1041 23068 316 2016 Filter [TRA] 1041 23068 519 11192 Filter stops in CDR3, OOF in CDR3 519 11192 456 10288 Downsample by umi automatic 456 10288 316 2016 nan nan
VFamilyUsage P19-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2474 30803 700 2016 Filter [TRA] 2474 30803 1289 17343 Filter stops in CDR3, OOF in CDR3 1289 17343 1044 14534 Downsample by umi automatic 1044 14534 700 2016 nan nan
VFamilyUsage P5-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 869 29425 225 2016 Filter [TRA] 869 29425 442 11193 Filter stops in CDR3, OOF in CDR3 442 11193 388 10506 Downsample by umi automatic 388 10506 225 2016 nan nan
VFamilyUsage P22-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 184 3144 69 1459 Filter [TRA] 184 3144 93 1827 Filter stops in CDR3, OOF in CDR3 93 1827 69 1459 Downsample by umi automatic 69 1459 69 1459 nan nan
VFamilyUsage P8-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1756 30662 329 2016 Filter [TRA] 1756 30662 963 20086 Filter stops in CDR3, OOF in CDR3 963 20086 824 18907 Downsample by umi automatic 824 18907 329 2016 nan nan
VFamilyUsage P22-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4777 44762 1030 2016 Filter [TRA] 4777 44762 2873 29196 Filter stops in CDR3, OOF in CDR3 2873 29196 2563 26610 Downsample by umi automatic 2563 26610 1030 2016 nan nan
VFamilyUsage P22-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2739 38839 744 2016 Filter [TRA] 2739 38839 1500 22460 Filter stops in CDR3, OOF in CDR3 1500 22460 1277 19749 Downsample by umi automatic 1277 19749 744 2016 nan nan
VFamilyUsage P19-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1122 19814 326 2016 Filter [TRA] 1122 19814 646 13010 Filter stops in CDR3, OOF in CDR3 646 13010 512 11091 Downsample by umi automatic 512 11091 326 2016 nan nan
VFamilyUsage P7-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2653 59321 560 2016 Filter [TRA] 2653 59321 1469 32629 Filter stops in CDR3, OOF in CDR3 1469 32629 1287 30146 Downsample by umi automatic 1287 30146 560 2016 nan nan
VFamilyUsage P16-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 741 22542 172 2016 Filter [TRA] 741 22542 362 11332 Filter stops in CDR3, OOF in CDR3 362 11332 307 10680 Downsample by umi automatic 307 10680 172 2016 nan nan
VFamilyUsage P16-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 196 632 69 246 Filter [TRA] 196 632 82 271 Filter stops in CDR3, OOF in CDR3 82 271 69 246 Downsample by umi automatic 69 246 69 246 nan nan
VFamilyUsage P8-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 192 479 73 189 Filter [TRA] 192 479 82 201 Filter stops in CDR3, OOF in CDR3 82 201 73 189 Downsample by umi automatic 73 189 73 189 nan nan
VFamilyUsage P22-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 866 17842 289 2016 Filter [TRA] 866 17842 470 10484 Filter stops in CDR3, OOF in CDR3 470 10484 399 9800 Downsample by umi automatic 399 9800 289 2016 nan nan
VFamilyUsage P6-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 793 14668 250 2016 Filter [TRA] 793 14668 348 5789 Filter stops in CDR3, OOF in CDR3 348 5789 282 4623 Downsample by umi automatic 282 4623 250 2016 nan nan
VFamilyUsage P6-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1136 9292 420 2016 Filter [TRA] 1136 9292 561 4134 Filter stops in CDR3, OOF in CDR3 561 4134 455 3565 Downsample by umi automatic 455 3565 420 2016 nan nan
VFamilyUsage P8-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2947 24377 809 2016 Filter [TRA] 2947 24377 1726 14772 Filter stops in CDR3, OOF in CDR3 1726 14772 1509 13347 Downsample by umi automatic 1509 13347 809 2016 nan nan
VFamilyUsage P6-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 729 11526 254 2016 Filter [TRA] 729 11526 374 4605 Filter stops in CDR3, OOF in CDR3 374 4605 308 3944 Downsample by umi automatic 308 3944 254 2016 nan nan
VFamilyUsage P8-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1510 24700 345 2016 Filter [TRA] 1510 24700 794 15444 Filter stops in CDR3, OOF in CDR3 794 15444 690 14490 Downsample by umi automatic 690 14490 345 2016 nan nan
VFamilyUsage P6-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1195 21037 282 2016 Filter [TRA] 1195 21037 508 10155 Filter stops in CDR3, OOF in CDR3 508 10155 437 9283 Downsample by umi automatic 437 9283 282 2016 nan nan
VFamilyUsage P15-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2263 26683 582 2016 Filter [TRA] 2263 26683 1306 16044 Filter stops in CDR3, OOF in CDR3 1306 16044 1164 14941 Downsample by umi automatic 1164 14941 582 2016 nan nan
VFamilyUsage P6-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 934 10171 304 2016 Filter [TRA] 934 10171 412 4318 Filter stops in CDR3, OOF in CDR3 412 4318 342 3737 Downsample by umi automatic 342 3737 304 2016 nan nan
VFamilyUsage P19-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 11499 93902 1316 2016 Filter [TRA] 11499 93902 6850 59878 Filter stops in CDR3, OOF in CDR3 6850 59878 6186 54877 Downsample by umi automatic 6186 54877 1316 2016 nan nan
VFamilyUsage P23-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 849 19675 199 2016 Filter [TRA] 849 19675 429 13349 Filter stops in CDR3, OOF in CDR3 429 13349 323 11839 Downsample by umi automatic 323 11839 199 2016 nan nan
VFamilyUsage P19-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3237 120680 334 2016 Filter [TRA] 3237 120680 1722 64163 Filter stops in CDR3, OOF in CDR3 1722 64163 1461 60213 Downsample by umi automatic 1461 60213 334 2016 nan nan
VFamilyUsage P8-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5958 52734 1134 2016 Filter [TRA] 5958 52734 3198 27819 Filter stops in CDR3, OOF in CDR3 3198 27819 2762 24346 Downsample by umi automatic 2762 24346 1134 2016 nan nan
VFamilyUsage P18-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1787 35836 383 2016 Filter [TRA] 1787 35836 1076 25619 Filter stops in CDR3, OOF in CDR3 1076 25619 927 24189 Downsample by umi automatic 927 24189 383 2016 nan nan
VFamilyUsage P5-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 234 4589 101 1163 Filter [TRA] 234 4589 113 1206 Filter stops in CDR3, OOF in CDR3 113 1206 101 1163 Downsample by umi automatic 101 1163 101 1163 nan nan
VFamilyUsage P21-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1400 16452 342 2016 Filter [TRA] 1400 16452 638 8000 Filter stops in CDR3, OOF in CDR3 638 8000 528 6980 Downsample by umi automatic 528 6980 342 2016 nan nan
VFamilyUsage P5-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3475 16013 935 2016 Filter [TRA] 3475 16013 1686 7601 Filter stops in CDR3, OOF in CDR3 1686 7601 1497 6823 Downsample by umi automatic 1497 6823 935 2016 nan nan
VFamilyUsage P22-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 809 14083 251 2016 Filter [TRA] 809 14083 376 7175 Filter stops in CDR3, OOF in CDR3 376 7175 301 5961 Downsample by umi automatic 301 5961 251 2016 nan nan
VFamilyUsage P23-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 61 798 32 511 Filter [TRA] 61 798 33 512 Filter stops in CDR3, OOF in CDR3 33 512 32 511 Downsample by umi automatic 32 511 32 511 nan nan
VFamilyUsage P14-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1371 10298 429 2016 Filter [TRA] 1371 10298 666 5078 Filter stops in CDR3, OOF in CDR3 666 5078 533 4224 Downsample by umi automatic 533 4224 429 2016 nan nan
VFamilyUsage P23-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 84 2020 46 1245 Filter [TRA] 84 2020 49 1308 Filter stops in CDR3, OOF in CDR3 49 1308 46 1245 Downsample by umi automatic 46 1245 46 1245 nan nan
VFamilyUsage P21-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 302 2936 134 1473 Filter [TRA] 302 2936 155 1509 Filter stops in CDR3, OOF in CDR3 155 1509 134 1473 Downsample by umi automatic 134 1473 134 1473 nan nan
VFamilyUsage P18-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1608 28518 329 2016 Filter [TRA] 1608 28518 905 20708 Filter stops in CDR3, OOF in CDR3 905 20708 777 19790 Downsample by umi automatic 777 19790 329 2016 nan nan
VFamilyUsage P21-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5509 53451 989 2016 Filter [TRA] 5509 53451 3126 31584 Filter stops in CDR3, OOF in CDR3 3126 31584 2774 28687 Downsample by umi automatic 2774 28687 989 2016 nan nan
VFamilyUsage P14-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 857 11817 249 2016 Filter [TRA] 857 11817 408 5231 Filter stops in CDR3, OOF in CDR3 408 5231 310 4379 Downsample by umi automatic 310 4379 249 2016 nan nan
VFamilyUsage P22-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 203 3836 69 1246 Filter [TRA] 203 3836 93 1762 Filter stops in CDR3, OOF in CDR3 93 1762 69 1246 Downsample by umi automatic 69 1246 69 1246 nan nan
VFamilyUsage P19-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1208 33259 284 2016 Filter [TRA] 1208 33259 610 18309 Filter stops in CDR3, OOF in CDR3 610 18309 494 16338 Downsample by umi automatic 494 16338 284 2016 nan nan
VFamilyUsage P7-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3182 32371 581 2016 Filter [TRA] 3182 32371 1804 15983 Filter stops in CDR3, OOF in CDR3 1804 15983 1603 14796 Downsample by umi automatic 1603 14796 581 2016 nan nan
VFamilyUsage P8-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2184 22698 495 2016 Filter [TRA] 2184 22698 1137 12476 Filter stops in CDR3, OOF in CDR3 1137 12476 943 11192 Downsample by umi automatic 943 11192 495 2016 nan nan
VFamilyUsage P18-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2236 22245 587 2016 Filter [TRA] 2236 22245 1436 16884 Filter stops in CDR3, OOF in CDR3 1436 16884 1265 15923 Downsample by umi automatic 1265 15923 587 2016 nan nan
VFamilyUsage P7-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 682 12237 235 2016 Filter [TRA] 682 12237 351 5527 Filter stops in CDR3, OOF in CDR3 351 5527 295 5077 Downsample by umi automatic 295 5077 235 2016 nan nan
VFamilyUsage P16-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1094 14551 330 2016 Filter [TRA] 1094 14551 481 4457 Filter stops in CDR3, OOF in CDR3 481 4457 398 3637 Downsample by umi automatic 398 3637 330 2016 nan nan
VFamilyUsage P21-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3034 36971 712 2016 Filter [TRA] 3034 36971 1468 17466 Filter stops in CDR3, OOF in CDR3 1468 17466 1236 15050 Downsample by umi automatic 1236 15050 712 2016 nan nan
VFamilyUsage P15-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2132 21847 551 2016 Filter [TRA] 2132 21847 1146 11718 Filter stops in CDR3, OOF in CDR3 1146 11718 1003 10650 Downsample by umi automatic 1003 10650 551 2016 nan nan
VFamilyUsage P16-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 403 7696 115 2016 Filter [TRA] 403 7696 154 2451 Filter stops in CDR3, OOF in CDR3 154 2451 115 2016 Downsample by umi automatic 115 2016 115 2016 nan nan
VFamilyUsage P6-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 466 11513 162 2016 Filter [TRA] 466 11513 219 5973 Filter stops in CDR3, OOF in CDR3 219 5973 191 5517 Downsample by umi automatic 191 5517 162 2016 nan nan
VFamilyUsage P22-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1464 34279 263 2016 Filter [TRA] 1464 34279 802 23169 Filter stops in CDR3, OOF in CDR3 802 23169 673 21892 Downsample by umi automatic 673 21892 263 2016 nan nan
VFamilyUsage P5-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2913 15674 914 2016 Filter [TRA] 2913 15674 1505 7803 Filter stops in CDR3, OOF in CDR3 1505 7803 1333 6867 Downsample by umi automatic 1333 6867 914 2016 nan nan
VFamilyUsage P22-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 439 5108 170 1863 Filter [TRA] 439 5108 204 2131 Filter stops in CDR3, OOF in CDR3 204 2131 170 1863 Downsample by umi automatic 170 1863 170 1863 nan nan
VFamilyUsage P18-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1487 19598 430 2016 Filter [TRA] 1487 19598 840 12726 Filter stops in CDR3, OOF in CDR3 840 12726 724 11766 Downsample by umi automatic 724 11766 430 2016 nan nan
VFamilyUsage P23-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 56 211 28 157 Filter [TRA] 56 211 30 160 Filter stops in CDR3, OOF in CDR3 30 160 28 157 Downsample by umi automatic 28 157 28 157 nan nan
VFamilyUsage P23-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 429 9768 115 2016 Filter [TRA] 429 9768 193 6018 Filter stops in CDR3, OOF in CDR3 193 6018 154 5457 Downsample by umi automatic 154 5457 115 2016 nan nan
VFamilyUsage P14-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5597 33873 1111 2016 Filter [TRA] 5597 33873 3274 20717 Filter stops in CDR3, OOF in CDR3 3274 20717 2923 18792 Downsample by umi automatic 2923 18792 1111 2016 nan nan
VFamilyUsage P5-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2016 19354 562 2016 Filter [TRA] 2016 19354 987 9735 Filter stops in CDR3, OOF in CDR3 987 9735 813 8405 Downsample by umi automatic 813 8405 562 2016 nan nan
VFamilyUsage P15-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 384 14053 88 2016 Filter [TRA] 384 14053 122 5209 Filter stops in CDR3, OOF in CDR3 122 5209 107 4974 Downsample by umi automatic 107 4974 88 2016 nan nan
VFamilyUsage P21-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2625 71373 368 2016 Filter [TRA] 2625 71373 1176 29286 Filter stops in CDR3, OOF in CDR3 1176 29286 982 26374 Downsample by umi automatic 982 26374 368 2016 nan nan
VFamilyUsage P6-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1749 14955 439 2016 Filter [TRA] 1749 14955 934 7190 Filter stops in CDR3, OOF in CDR3 934 7190 791 6350 Downsample by umi automatic 791 6350 439 2016 nan nan
VFamilyUsage P7-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1260 19213 339 2016 Filter [TRA] 1260 19213 672 10418 Filter stops in CDR3, OOF in CDR3 672 10418 581 9581 Downsample by umi automatic 581 9581 339 2016 nan nan
VFamilyUsage P5-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 6741 39464 1273 2016 Filter [TRA] 6741 39464 3403 19372 Filter stops in CDR3, OOF in CDR3 3403 19372 3048 17445 Downsample by umi automatic 3048 17445 1273 2016 nan nan
VFamilyUsage P14-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1477 13248 474 2016 Filter [TRA] 1477 13248 771 7122 Filter stops in CDR3, OOF in CDR3 771 7122 594 5649 Downsample by umi automatic 594 5649 474 2016 nan nan
VFamilyUsage P8-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 416 7631 156 2016 Filter [TRA] 416 7631 208 4589 Filter stops in CDR3, OOF in CDR3 208 4589 173 4026 Downsample by umi automatic 173 4026 156 2016 nan nan
VFamilyUsage P15-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1342 17938 352 2016 Filter [TRA] 1342 17938 746 11460 Filter stops in CDR3, OOF in CDR3 746 11460 668 10871 Downsample by umi automatic 668 10871 352 2016 nan nan
VFamilyUsage P5-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 918 8033 283 2016 Filter [TRA] 918 8033 396 3976 Filter stops in CDR3, OOF in CDR3 396 3976 315 3366 Downsample by umi automatic 315 3366 283 2016 nan nan
VFamilyUsage P14-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4056 40242 704 2016 Filter [TRA] 4056 40242 2212 21592 Filter stops in CDR3, OOF in CDR3 2212 21592 1935 19626 Downsample by umi automatic 1935 19626 704 2016 nan nan
VFamilyUsage P6-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 299 7035 87 2016 Filter [TRA] 299 7035 111 2745 Filter stops in CDR3, OOF in CDR3 111 2745 89 2487 Downsample by umi automatic 89 2487 87 2016 nan nan
VFamilyUsage P19-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1195 37333 266 2016 Filter [TRA] 1195 37333 600 17870 Filter stops in CDR3, OOF in CDR3 600 17870 485 15496 Downsample by umi automatic 485 15496 266 2016 nan nan
VFamilyUsage P7-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1436 42241 289 2016 Filter [TRA] 1436 42241 763 25899 Filter stops in CDR3, OOF in CDR3 763 25899 674 24822 Downsample by umi automatic 674 24822 289 2016 nan nan
VFamilyUsage P7-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1719 30086 453 2016 Filter [TRA] 1719 30086 904 14672 Filter stops in CDR3, OOF in CDR3 904 14672 801 13316 Downsample by umi automatic 801 13316 453 2016 nan nan
VFamilyUsage P16-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1297 29448 283 2016 Filter [TRA] 1297 29448 625 11891 Filter stops in CDR3, OOF in CDR3 625 11891 532 11006 Downsample by umi automatic 532 11006 283 2016 nan nan
VFamilyUsage P15-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1670 24195 430 2016 Filter [TRA] 1670 24195 919 14281 Filter stops in CDR3, OOF in CDR3 919 14281 803 13407 Downsample by umi automatic 803 13407 430 2016 nan nan
VFamilyUsage P21-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 293 3045 138 1463 Filter [TRA] 293 3045 152 1621 Filter stops in CDR3, OOF in CDR3 152 1621 138 1463 Downsample by umi automatic 138 1463 138 1463 nan nan
VFamilyUsage P8-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3555 35039 812 2016 Filter [TRA] 3555 35039 1914 18753 Filter stops in CDR3, OOF in CDR3 1914 18753 1653 16546 Downsample by umi automatic 1653 16546 812 2016 nan nan
VFamilyUsage P22-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2311 21151 562 2016 Filter [TRA] 2311 21151 1156 10936 Filter stops in CDR3, OOF in CDR3 1156 10936 946 9521 Downsample by umi automatic 946 9521 562 2016 nan nan
VFamilyUsage P21-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 635 9672 217 2016 Filter [TRA] 635 9672 305 5202 Filter stops in CDR3, OOF in CDR3 305 5202 267 4735 Downsample by umi automatic 267 4735 217 2016 nan nan
VFamilyUsage P18-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2160 36838 607 2016 Filter [TRA] 2160 36838 1284 25604 Filter stops in CDR3, OOF in CDR3 1284 25604 1135 24185 Downsample by umi automatic 1135 24185 607 2016 nan nan
VFamilyUsage P7-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 985 24058 292 2016 Filter [TRA] 985 24058 501 12296 Filter stops in CDR3, OOF in CDR3 501 12296 445 11576 Downsample by umi automatic 445 11576 292 2016 nan nan
VFamilyUsage P15-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 874 13573 223 2016 Filter [TRA] 874 13573 317 5182 Filter stops in CDR3, OOF in CDR3 317 5182 262 4603 Downsample by umi automatic 262 4603 223 2016 nan nan
VFamilyUsage P16-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 747 19373 232 2016 Filter [TRA] 747 19373 342 8091 Filter stops in CDR3, OOF in CDR3 342 8091 272 7017 Downsample by umi automatic 272 7017 232 2016 nan nan
VFamilyUsage P19-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5664 31152 1157 2016 Filter [TRA] 5664 31152 3625 20596 Filter stops in CDR3, OOF in CDR3 3625 20596 3046 17766 Downsample by umi automatic 3046 17766 1157 2016 nan nan
VFamilyUsage P19-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 705 36623 218 2016 Filter [TRA] 705 36623 348 16970 Filter stops in CDR3, OOF in CDR3 348 16970 266 13616 Downsample by umi automatic 266 13616 218 2016 nan nan
VFamilyUsage P15-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1132 18243 288 2016 Filter [TRA] 1132 18243 471 8159 Filter stops in CDR3, OOF in CDR3 471 8159 375 7130 Downsample by umi automatic 375 7130 288 2016 nan nan
VFamilyUsage P23-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1042 15910 307 2016 Filter [TRA] 1042 15910 626 11323 Filter stops in CDR3, OOF in CDR3 626 11323 491 9848 Downsample by umi automatic 491 9848 307 2016 nan nan
VFamilyUsage P14-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1533 19460 433 2016 Filter [TRA] 1533 19460 700 8413 Filter stops in CDR3, OOF in CDR3 700 8413 529 6712 Downsample by umi automatic 529 6712 433 2016 nan nan
VFamilyUsage P21-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 322 3195 152 1134 Filter [TRA] 322 3195 168 1263 Filter stops in CDR3, OOF in CDR3 168 1263 152 1134 Downsample by umi automatic 152 1134 152 1134 nan nan
VFamilyUsage P21-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 604 12389 191 2016 Filter [TRA] 604 12389 296 6443 Filter stops in CDR3, OOF in CDR3 296 6443 259 5661 Downsample by umi automatic 259 5661 191 2016 nan nan
VFamilyUsage P8-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1639 27706 345 2016 Filter [TRA] 1639 27706 882 15118 Filter stops in CDR3, OOF in CDR3 882 15118 740 14283 Downsample by umi automatic 740 14283 345 2016 nan nan
VFamilyUsage P14-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 312 7498 97 2016 Filter [TRA] 312 7498 122 2849 Filter stops in CDR3, OOF in CDR3 122 2849 99 2073 Downsample by umi automatic 99 2073 97 2016 nan nan
VFamilyUsage P18-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 726 10685 283 2016 Filter [TRA] 726 10685 420 7426 Filter stops in CDR3, OOF in CDR3 420 7426 365 6921 Downsample by umi automatic 365 6921 283 2016 nan nan
VFamilyUsage P14-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4913 38152 812 2016 Filter [TRA] 4913 38152 2794 23198 Filter stops in CDR3, OOF in CDR3 2794 23198 2473 21699 Downsample by umi automatic 2473 21699 812 2016 nan nan
VFamilyUsage P7-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1681 47083 366 2016 Filter [TRA] 1681 47083 918 21571 Filter stops in CDR3, OOF in CDR3 918 21571 781 19605 Downsample by umi automatic 781 19605 366 2016 nan nan
VFamilyUsage P16-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1252 22292 368 2016 Filter [TRA] 1252 22292 619 8996 Filter stops in CDR3, OOF in CDR3 619 8996 498 7580 Downsample by umi automatic 498 7580 368 2016 nan nan
VFamilyUsage P8-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 571 14348 187 2016 Filter [TRA] 571 14348 276 6486 Filter stops in CDR3, OOF in CDR3 276 6486 231 6117 Downsample by umi automatic 231 6117 187 2016 nan nan
VFamilyUsage P19-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 863 19338 182 2016 Filter [TRA] 863 19338 394 10415 Filter stops in CDR3, OOF in CDR3 394 10415 323 9915 Downsample by umi automatic 323 9915 182 2016 nan nan
VFamilyUsage P18-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1871 24519 514 2016 Filter [TRA] 1871 24519 1085 17458 Filter stops in CDR3, OOF in CDR3 1085 17458 952 16490 Downsample by umi automatic 952 16490 514 2016 nan nan
VFamilyUsage P15-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1206 13963 402 2016 Filter [TRA] 1206 13963 627 7619 Filter stops in CDR3, OOF in CDR3 627 7619 543 7061 Downsample by umi automatic 543 7061 402 2016 nan nan
VFamilyUsage P5-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3223 18148 873 2016 Filter [TRA] 3223 18148 1755 10270 Filter stops in CDR3, OOF in CDR3 1755 10270 1491 8805 Downsample by umi automatic 1491 8805 873 2016 nan nan
VFamilyUsage P23-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 416 15776 141 2016 Filter [TRA] 416 15776 223 9081 Filter stops in CDR3, OOF in CDR3 223 9081 181 7764 Downsample by umi automatic 181 7764 141 2016 nan nan
VFamilyUsage P5-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1787 22667 437 2016 Filter [TRA] 1787 22667 892 12934 Filter stops in CDR3, OOF in CDR3 892 12934 750 12099 Downsample by umi automatic 750 12099 437 2016 nan nan
VFamilyUsage P16-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 493 11795 131 2016 Filter [TRA] 493 11795 204 4121 Filter stops in CDR3, OOF in CDR3 204 4121 173 3905 Downsample by umi automatic 173 3905 131 2016 nan nan
VFamilyUsage P18-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2538 69555 386 2016 Filter [TRA] 2538 69555 1285 39291 Filter stops in CDR3, OOF in CDR3 1285 39291 1102 36853 Downsample by umi automatic 1102 36853 386 2016 nan nan
VFamilyUsage P7-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2529 68105 286 2016 Filter [TRA] 2529 68105 1367 39894 Filter stops in CDR3, OOF in CDR3 1367 39894 1179 36468 Downsample by umi automatic 1179 36468 286 2016 nan nan
VFamilyUsage P18-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1092 16951 365 2016 Filter [TRA] 1092 16951 629 11506 Filter stops in CDR3, OOF in CDR3 629 11506 519 10157 Downsample by umi automatic 519 10157 365 2016 nan nan
VFamilyUsage P19-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 427 9195 145 2016 Filter [TRA] 427 9195 221 4852 Filter stops in CDR3, OOF in CDR3 221 4852 170 4070 Downsample by umi automatic 170 4070 145 2016 nan nan
VFamilyUsage P15-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 997 11499 280 2016 Filter [TRA] 997 11499 389 4310 Filter stops in CDR3, OOF in CDR3 389 4310 313 3508 Downsample by umi automatic 313 3508 280 2016 nan nan
VFamilyUsage P14-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 405 13665 98 2016 Filter [TRA] 405 13665 163 4616 Filter stops in CDR3, OOF in CDR3 163 4616 110 3463 Downsample by umi automatic 110 3463 98 2016 nan nan
IsotypeUsage P14-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 704 9455 215 2016 Filter [TRA] 704 9455 279 3442 Filter stops in CDR3, OOF in CDR3 279 3442 242 3048 Downsample by umi automatic 242 3048 215 2016 nan nan
IsotypeUsage P16-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 581 9645 132 2016 Filter [TRA] 581 9645 228 4514 Filter stops in CDR3, OOF in CDR3 228 4514 172 3994 Downsample by umi automatic 172 3994 132 2016 nan nan
IsotypeUsage P21-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1076 11773 331 2016 Filter [TRA] 1076 11773 520 5325 Filter stops in CDR3, OOF in CDR3 520 5325 458 4933 Downsample by umi automatic 458 4933 331 2016 nan nan
IsotypeUsage P23-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 80 579 36 180 Filter [TRA] 80 579 40 184 Filter stops in CDR3, OOF in CDR3 40 184 36 180 Downsample by umi automatic 36 180 36 180 nan nan
IsotypeUsage P19-M2PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2090 45179 317 2016 Filter [TRA] 2090 45179 1147 30548 Filter stops in CDR3, OOF in CDR3 1147 30548 987 29429 Downsample by umi automatic 987 29429 317 2016 nan nan
IsotypeUsage P21-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 960 19855 280 2016 Filter [TRA] 960 19855 510 11141 Filter stops in CDR3, OOF in CDR3 510 11141 429 10081 Downsample by umi automatic 429 10081 280 2016 nan nan
IsotypeUsage P5-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 789 31519 167 2016 Filter [TRA] 789 31519 400 17067 Filter stops in CDR3, OOF in CDR3 400 17067 352 15973 Downsample by umi automatic 352 15973 167 2016 nan nan
IsotypeUsage P8-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1209 37998 258 2016 Filter [TRA] 1209 37998 655 21649 Filter stops in CDR3, OOF in CDR3 655 21649 561 20541 Downsample by umi automatic 561 20541 258 2016 nan nan
IsotypeUsage P18-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2066 92011 452 2016 Filter [TRA] 2066 92011 1222 63269 Filter stops in CDR3, OOF in CDR3 1222 63269 1033 59264 Downsample by umi automatic 1033 59264 452 2016 nan nan
IsotypeUsage P16-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 331 10152 75 2016 Filter [TRA] 331 10152 120 4312 Filter stops in CDR3, OOF in CDR3 120 4312 93 3666 Downsample by umi automatic 93 3666 75 2016 nan nan
IsotypeUsage P22-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 258 7836 88 2016 Filter [TRA] 258 7836 124 3923 Filter stops in CDR3, OOF in CDR3 124 3923 99 3177 Downsample by umi automatic 99 3177 88 2016 nan nan
IsotypeUsage P18-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1709 31160 395 2016 Filter [TRA] 1709 31160 964 22048 Filter stops in CDR3, OOF in CDR3 964 22048 848 21055 Downsample by umi automatic 848 21055 395 2016 nan nan
IsotypeUsage P5-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 669 8934 262 2016 Filter [TRA] 669 8934 341 5148 Filter stops in CDR3, OOF in CDR3 341 5148 297 4553 Downsample by umi automatic 297 4553 262 2016 nan nan
IsotypeUsage P22-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1593 50054 301 2016 Filter [TRA] 1593 50054 873 32294 Filter stops in CDR3, OOF in CDR3 873 32294 721 29971 Downsample by umi automatic 721 29971 301 2016 nan nan
IsotypeUsage P16-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 880 15352 249 2016 Filter [TRA] 880 15352 445 6911 Filter stops in CDR3, OOF in CDR3 445 6911 355 6074 Downsample by umi automatic 355 6074 249 2016 nan nan
IsotypeUsage P7-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1720 33563 360 2016 Filter [TRA] 1720 33563 986 22404 Filter stops in CDR3, OOF in CDR3 986 22404 864 20675 Downsample by umi automatic 864 20675 360 2016 nan nan
IsotypeUsage P15-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2401 18323 745 2016 Filter [TRA] 2401 18323 1355 10634 Filter stops in CDR3, OOF in CDR3 1355 10634 1221 9710 Downsample by umi automatic 1221 9710 745 2016 nan nan
IsotypeUsage P16-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1264 20091 360 2016 Filter [TRA] 1264 20091 705 10909 Filter stops in CDR3, OOF in CDR3 705 10909 619 10226 Downsample by umi automatic 619 10226 360 2016 nan nan
IsotypeUsage P15-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2596 15442 829 2016 Filter [TRA] 2596 15442 1406 8725 Filter stops in CDR3, OOF in CDR3 1406 8725 1241 7797 Downsample by umi automatic 1241 7797 829 2016 nan nan
IsotypeUsage P14-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1631 14813 520 2016 Filter [TRA] 1631 14813 909 7948 Filter stops in CDR3, OOF in CDR3 909 7948 795 7429 Downsample by umi automatic 795 7429 520 2016 nan nan
IsotypeUsage P7-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 708 16707 153 2016 Filter [TRA] 708 16707 366 10791 Filter stops in CDR3, OOF in CDR3 366 10791 306 10337 Downsample by umi automatic 306 10337 153 2016 nan nan
IsotypeUsage P7-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3854 40098 549 2016 Filter [TRA] 3854 40098 2133 23481 Filter stops in CDR3, OOF in CDR3 2133 23481 1887 21846 Downsample by umi automatic 1887 21846 549 2016 nan nan
IsotypeUsage P18-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1815 31892 388 2016 Filter [TRA] 1815 31892 1027 20669 Filter stops in CDR3, OOF in CDR3 1027 20669 883 19505 Downsample by umi automatic 883 19505 388 2016 nan nan
IsotypeUsage P15-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 749 15816 239 2016 Filter [TRA] 749 15816 399 10978 Filter stops in CDR3, OOF in CDR3 399 10978 360 10654 Downsample by umi automatic 360 10654 239 2016 nan nan
IsotypeUsage P8-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 836 20403 223 2016 Filter [TRA] 836 20403 416 12545 Filter stops in CDR3, OOF in CDR3 416 12545 359 11838 Downsample by umi automatic 359 11838 223 2016 nan nan
IsotypeUsage P19-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2532 67648 333 2016 Filter [TRA] 2532 67648 1394 40352 Filter stops in CDR3, OOF in CDR3 1394 40352 1174 37896 Downsample by umi automatic 1174 37896 333 2016 nan nan
IsotypeUsage P14-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1202 15201 294 2016 Filter [TRA] 1202 15201 516 6933 Filter stops in CDR3, OOF in CDR3 516 6933 402 5790 Downsample by umi automatic 402 5790 294 2016 nan nan
IsotypeUsage P5-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2745 24504 633 2016 Filter [TRA] 2745 24504 1393 12912 Filter stops in CDR3, OOF in CDR3 1393 12912 1264 12134 Downsample by umi automatic 1264 12134 633 2016 nan nan
IsotypeUsage P22-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2380 53898 491 2016 Filter [TRA] 2380 53898 1294 31762 Filter stops in CDR3, OOF in CDR3 1294 31762 1099 29827 Downsample by umi automatic 1099 29827 491 2016 nan nan
IsotypeUsage P21-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1041 23068 316 2016 Filter [TRA] 1041 23068 519 11192 Filter stops in CDR3, OOF in CDR3 519 11192 456 10288 Downsample by umi automatic 456 10288 316 2016 nan nan
IsotypeUsage P19-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2474 30803 700 2016 Filter [TRA] 2474 30803 1289 17343 Filter stops in CDR3, OOF in CDR3 1289 17343 1044 14534 Downsample by umi automatic 1044 14534 700 2016 nan nan
IsotypeUsage P5-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 869 29425 225 2016 Filter [TRA] 869 29425 442 11193 Filter stops in CDR3, OOF in CDR3 442 11193 388 10506 Downsample by umi automatic 388 10506 225 2016 nan nan
IsotypeUsage P22-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 184 3144 69 1459 Filter [TRA] 184 3144 93 1827 Filter stops in CDR3, OOF in CDR3 93 1827 69 1459 Downsample by umi automatic 69 1459 69 1459 nan nan
IsotypeUsage P8-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1756 30662 329 2016 Filter [TRA] 1756 30662 963 20086 Filter stops in CDR3, OOF in CDR3 963 20086 824 18907 Downsample by umi automatic 824 18907 329 2016 nan nan
IsotypeUsage P22-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4777 44762 1030 2016 Filter [TRA] 4777 44762 2873 29196 Filter stops in CDR3, OOF in CDR3 2873 29196 2563 26610 Downsample by umi automatic 2563 26610 1030 2016 nan nan
IsotypeUsage P22-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2739 38839 744 2016 Filter [TRA] 2739 38839 1500 22460 Filter stops in CDR3, OOF in CDR3 1500 22460 1277 19749 Downsample by umi automatic 1277 19749 744 2016 nan nan
IsotypeUsage P19-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1122 19814 326 2016 Filter [TRA] 1122 19814 646 13010 Filter stops in CDR3, OOF in CDR3 646 13010 512 11091 Downsample by umi automatic 512 11091 326 2016 nan nan
IsotypeUsage P7-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2653 59321 560 2016 Filter [TRA] 2653 59321 1469 32629 Filter stops in CDR3, OOF in CDR3 1469 32629 1287 30146 Downsample by umi automatic 1287 30146 560 2016 nan nan
IsotypeUsage P16-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 741 22542 172 2016 Filter [TRA] 741 22542 362 11332 Filter stops in CDR3, OOF in CDR3 362 11332 307 10680 Downsample by umi automatic 307 10680 172 2016 nan nan
IsotypeUsage P16-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 196 632 69 246 Filter [TRA] 196 632 82 271 Filter stops in CDR3, OOF in CDR3 82 271 69 246 Downsample by umi automatic 69 246 69 246 nan nan
IsotypeUsage P8-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 192 479 73 189 Filter [TRA] 192 479 82 201 Filter stops in CDR3, OOF in CDR3 82 201 73 189 Downsample by umi automatic 73 189 73 189 nan nan
IsotypeUsage P22-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 866 17842 289 2016 Filter [TRA] 866 17842 470 10484 Filter stops in CDR3, OOF in CDR3 470 10484 399 9800 Downsample by umi automatic 399 9800 289 2016 nan nan
IsotypeUsage P6-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 793 14668 250 2016 Filter [TRA] 793 14668 348 5789 Filter stops in CDR3, OOF in CDR3 348 5789 282 4623 Downsample by umi automatic 282 4623 250 2016 nan nan
IsotypeUsage P6-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1136 9292 420 2016 Filter [TRA] 1136 9292 561 4134 Filter stops in CDR3, OOF in CDR3 561 4134 455 3565 Downsample by umi automatic 455 3565 420 2016 nan nan
IsotypeUsage P8-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2947 24377 809 2016 Filter [TRA] 2947 24377 1726 14772 Filter stops in CDR3, OOF in CDR3 1726 14772 1509 13347 Downsample by umi automatic 1509 13347 809 2016 nan nan
IsotypeUsage P6-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 729 11526 254 2016 Filter [TRA] 729 11526 374 4605 Filter stops in CDR3, OOF in CDR3 374 4605 308 3944 Downsample by umi automatic 308 3944 254 2016 nan nan
IsotypeUsage P8-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1510 24700 345 2016 Filter [TRA] 1510 24700 794 15444 Filter stops in CDR3, OOF in CDR3 794 15444 690 14490 Downsample by umi automatic 690 14490 345 2016 nan nan
IsotypeUsage P6-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1195 21037 282 2016 Filter [TRA] 1195 21037 508 10155 Filter stops in CDR3, OOF in CDR3 508 10155 437 9283 Downsample by umi automatic 437 9283 282 2016 nan nan
IsotypeUsage P15-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2263 26683 582 2016 Filter [TRA] 2263 26683 1306 16044 Filter stops in CDR3, OOF in CDR3 1306 16044 1164 14941 Downsample by umi automatic 1164 14941 582 2016 nan nan
IsotypeUsage P6-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 934 10171 304 2016 Filter [TRA] 934 10171 412 4318 Filter stops in CDR3, OOF in CDR3 412 4318 342 3737 Downsample by umi automatic 342 3737 304 2016 nan nan
IsotypeUsage P19-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 11499 93902 1316 2016 Filter [TRA] 11499 93902 6850 59878 Filter stops in CDR3, OOF in CDR3 6850 59878 6186 54877 Downsample by umi automatic 6186 54877 1316 2016 nan nan
IsotypeUsage P23-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 849 19675 199 2016 Filter [TRA] 849 19675 429 13349 Filter stops in CDR3, OOF in CDR3 429 13349 323 11839 Downsample by umi automatic 323 11839 199 2016 nan nan
IsotypeUsage P19-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3237 120680 334 2016 Filter [TRA] 3237 120680 1722 64163 Filter stops in CDR3, OOF in CDR3 1722 64163 1461 60213 Downsample by umi automatic 1461 60213 334 2016 nan nan
IsotypeUsage P8-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5958 52734 1134 2016 Filter [TRA] 5958 52734 3198 27819 Filter stops in CDR3, OOF in CDR3 3198 27819 2762 24346 Downsample by umi automatic 2762 24346 1134 2016 nan nan
IsotypeUsage P18-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1787 35836 383 2016 Filter [TRA] 1787 35836 1076 25619 Filter stops in CDR3, OOF in CDR3 1076 25619 927 24189 Downsample by umi automatic 927 24189 383 2016 nan nan
IsotypeUsage P5-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 234 4589 101 1163 Filter [TRA] 234 4589 113 1206 Filter stops in CDR3, OOF in CDR3 113 1206 101 1163 Downsample by umi automatic 101 1163 101 1163 nan nan
IsotypeUsage P21-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1400 16452 342 2016 Filter [TRA] 1400 16452 638 8000 Filter stops in CDR3, OOF in CDR3 638 8000 528 6980 Downsample by umi automatic 528 6980 342 2016 nan nan
IsotypeUsage P5-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3475 16013 935 2016 Filter [TRA] 3475 16013 1686 7601 Filter stops in CDR3, OOF in CDR3 1686 7601 1497 6823 Downsample by umi automatic 1497 6823 935 2016 nan nan
IsotypeUsage P22-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 809 14083 251 2016 Filter [TRA] 809 14083 376 7175 Filter stops in CDR3, OOF in CDR3 376 7175 301 5961 Downsample by umi automatic 301 5961 251 2016 nan nan
IsotypeUsage P23-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 61 798 32 511 Filter [TRA] 61 798 33 512 Filter stops in CDR3, OOF in CDR3 33 512 32 511 Downsample by umi automatic 32 511 32 511 nan nan
IsotypeUsage P14-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1371 10298 429 2016 Filter [TRA] 1371 10298 666 5078 Filter stops in CDR3, OOF in CDR3 666 5078 533 4224 Downsample by umi automatic 533 4224 429 2016 nan nan
IsotypeUsage P23-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 84 2020 46 1245 Filter [TRA] 84 2020 49 1308 Filter stops in CDR3, OOF in CDR3 49 1308 46 1245 Downsample by umi automatic 46 1245 46 1245 nan nan
IsotypeUsage P21-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 302 2936 134 1473 Filter [TRA] 302 2936 155 1509 Filter stops in CDR3, OOF in CDR3 155 1509 134 1473 Downsample by umi automatic 134 1473 134 1473 nan nan
IsotypeUsage P18-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1608 28518 329 2016 Filter [TRA] 1608 28518 905 20708 Filter stops in CDR3, OOF in CDR3 905 20708 777 19790 Downsample by umi automatic 777 19790 329 2016 nan nan
IsotypeUsage P21-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5509 53451 989 2016 Filter [TRA] 5509 53451 3126 31584 Filter stops in CDR3, OOF in CDR3 3126 31584 2774 28687 Downsample by umi automatic 2774 28687 989 2016 nan nan
IsotypeUsage P14-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 857 11817 249 2016 Filter [TRA] 857 11817 408 5231 Filter stops in CDR3, OOF in CDR3 408 5231 310 4379 Downsample by umi automatic 310 4379 249 2016 nan nan
IsotypeUsage P22-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 203 3836 69 1246 Filter [TRA] 203 3836 93 1762 Filter stops in CDR3, OOF in CDR3 93 1762 69 1246 Downsample by umi automatic 69 1246 69 1246 nan nan
IsotypeUsage P19-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1208 33259 284 2016 Filter [TRA] 1208 33259 610 18309 Filter stops in CDR3, OOF in CDR3 610 18309 494 16338 Downsample by umi automatic 494 16338 284 2016 nan nan
IsotypeUsage P7-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3182 32371 581 2016 Filter [TRA] 3182 32371 1804 15983 Filter stops in CDR3, OOF in CDR3 1804 15983 1603 14796 Downsample by umi automatic 1603 14796 581 2016 nan nan
IsotypeUsage P8-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2184 22698 495 2016 Filter [TRA] 2184 22698 1137 12476 Filter stops in CDR3, OOF in CDR3 1137 12476 943 11192 Downsample by umi automatic 943 11192 495 2016 nan nan
IsotypeUsage P18-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2236 22245 587 2016 Filter [TRA] 2236 22245 1436 16884 Filter stops in CDR3, OOF in CDR3 1436 16884 1265 15923 Downsample by umi automatic 1265 15923 587 2016 nan nan
IsotypeUsage P7-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 682 12237 235 2016 Filter [TRA] 682 12237 351 5527 Filter stops in CDR3, OOF in CDR3 351 5527 295 5077 Downsample by umi automatic 295 5077 235 2016 nan nan
IsotypeUsage P16-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1094 14551 330 2016 Filter [TRA] 1094 14551 481 4457 Filter stops in CDR3, OOF in CDR3 481 4457 398 3637 Downsample by umi automatic 398 3637 330 2016 nan nan
IsotypeUsage P21-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3034 36971 712 2016 Filter [TRA] 3034 36971 1468 17466 Filter stops in CDR3, OOF in CDR3 1468 17466 1236 15050 Downsample by umi automatic 1236 15050 712 2016 nan nan
IsotypeUsage P15-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2132 21847 551 2016 Filter [TRA] 2132 21847 1146 11718 Filter stops in CDR3, OOF in CDR3 1146 11718 1003 10650 Downsample by umi automatic 1003 10650 551 2016 nan nan
IsotypeUsage P16-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 403 7696 115 2016 Filter [TRA] 403 7696 154 2451 Filter stops in CDR3, OOF in CDR3 154 2451 115 2016 Downsample by umi automatic 115 2016 115 2016 nan nan
IsotypeUsage P6-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 466 11513 162 2016 Filter [TRA] 466 11513 219 5973 Filter stops in CDR3, OOF in CDR3 219 5973 191 5517 Downsample by umi automatic 191 5517 162 2016 nan nan
IsotypeUsage P22-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1464 34279 263 2016 Filter [TRA] 1464 34279 802 23169 Filter stops in CDR3, OOF in CDR3 802 23169 673 21892 Downsample by umi automatic 673 21892 263 2016 nan nan
IsotypeUsage P5-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2913 15674 914 2016 Filter [TRA] 2913 15674 1505 7803 Filter stops in CDR3, OOF in CDR3 1505 7803 1333 6867 Downsample by umi automatic 1333 6867 914 2016 nan nan
IsotypeUsage P22-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 439 5108 170 1863 Filter [TRA] 439 5108 204 2131 Filter stops in CDR3, OOF in CDR3 204 2131 170 1863 Downsample by umi automatic 170 1863 170 1863 nan nan
IsotypeUsage P18-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1487 19598 430 2016 Filter [TRA] 1487 19598 840 12726 Filter stops in CDR3, OOF in CDR3 840 12726 724 11766 Downsample by umi automatic 724 11766 430 2016 nan nan
IsotypeUsage P23-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 56 211 28 157 Filter [TRA] 56 211 30 160 Filter stops in CDR3, OOF in CDR3 30 160 28 157 Downsample by umi automatic 28 157 28 157 nan nan
IsotypeUsage P23-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 429 9768 115 2016 Filter [TRA] 429 9768 193 6018 Filter stops in CDR3, OOF in CDR3 193 6018 154 5457 Downsample by umi automatic 154 5457 115 2016 nan nan
IsotypeUsage P14-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5597 33873 1111 2016 Filter [TRA] 5597 33873 3274 20717 Filter stops in CDR3, OOF in CDR3 3274 20717 2923 18792 Downsample by umi automatic 2923 18792 1111 2016 nan nan
IsotypeUsage P5-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2016 19354 562 2016 Filter [TRA] 2016 19354 987 9735 Filter stops in CDR3, OOF in CDR3 987 9735 813 8405 Downsample by umi automatic 813 8405 562 2016 nan nan
IsotypeUsage P15-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 384 14053 88 2016 Filter [TRA] 384 14053 122 5209 Filter stops in CDR3, OOF in CDR3 122 5209 107 4974 Downsample by umi automatic 107 4974 88 2016 nan nan
IsotypeUsage P21-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2625 71373 368 2016 Filter [TRA] 2625 71373 1176 29286 Filter stops in CDR3, OOF in CDR3 1176 29286 982 26374 Downsample by umi automatic 982 26374 368 2016 nan nan
IsotypeUsage P6-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1749 14955 439 2016 Filter [TRA] 1749 14955 934 7190 Filter stops in CDR3, OOF in CDR3 934 7190 791 6350 Downsample by umi automatic 791 6350 439 2016 nan nan
IsotypeUsage P7-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1260 19213 339 2016 Filter [TRA] 1260 19213 672 10418 Filter stops in CDR3, OOF in CDR3 672 10418 581 9581 Downsample by umi automatic 581 9581 339 2016 nan nan
IsotypeUsage P5-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 6741 39464 1273 2016 Filter [TRA] 6741 39464 3403 19372 Filter stops in CDR3, OOF in CDR3 3403 19372 3048 17445 Downsample by umi automatic 3048 17445 1273 2016 nan nan
IsotypeUsage P14-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1477 13248 474 2016 Filter [TRA] 1477 13248 771 7122 Filter stops in CDR3, OOF in CDR3 771 7122 594 5649 Downsample by umi automatic 594 5649 474 2016 nan nan
IsotypeUsage P8-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 416 7631 156 2016 Filter [TRA] 416 7631 208 4589 Filter stops in CDR3, OOF in CDR3 208 4589 173 4026 Downsample by umi automatic 173 4026 156 2016 nan nan
IsotypeUsage P15-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1342 17938 352 2016 Filter [TRA] 1342 17938 746 11460 Filter stops in CDR3, OOF in CDR3 746 11460 668 10871 Downsample by umi automatic 668 10871 352 2016 nan nan
IsotypeUsage P5-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 918 8033 283 2016 Filter [TRA] 918 8033 396 3976 Filter stops in CDR3, OOF in CDR3 396 3976 315 3366 Downsample by umi automatic 315 3366 283 2016 nan nan
IsotypeUsage P14-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4056 40242 704 2016 Filter [TRA] 4056 40242 2212 21592 Filter stops in CDR3, OOF in CDR3 2212 21592 1935 19626 Downsample by umi automatic 1935 19626 704 2016 nan nan
IsotypeUsage P6-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 299 7035 87 2016 Filter [TRA] 299 7035 111 2745 Filter stops in CDR3, OOF in CDR3 111 2745 89 2487 Downsample by umi automatic 89 2487 87 2016 nan nan
IsotypeUsage P19-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1195 37333 266 2016 Filter [TRA] 1195 37333 600 17870 Filter stops in CDR3, OOF in CDR3 600 17870 485 15496 Downsample by umi automatic 485 15496 266 2016 nan nan
IsotypeUsage P7-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1436 42241 289 2016 Filter [TRA] 1436 42241 763 25899 Filter stops in CDR3, OOF in CDR3 763 25899 674 24822 Downsample by umi automatic 674 24822 289 2016 nan nan
IsotypeUsage P7-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1719 30086 453 2016 Filter [TRA] 1719 30086 904 14672 Filter stops in CDR3, OOF in CDR3 904 14672 801 13316 Downsample by umi automatic 801 13316 453 2016 nan nan
IsotypeUsage P16-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1297 29448 283 2016 Filter [TRA] 1297 29448 625 11891 Filter stops in CDR3, OOF in CDR3 625 11891 532 11006 Downsample by umi automatic 532 11006 283 2016 nan nan
IsotypeUsage P15-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1670 24195 430 2016 Filter [TRA] 1670 24195 919 14281 Filter stops in CDR3, OOF in CDR3 919 14281 803 13407 Downsample by umi automatic 803 13407 430 2016 nan nan
IsotypeUsage P21-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 293 3045 138 1463 Filter [TRA] 293 3045 152 1621 Filter stops in CDR3, OOF in CDR3 152 1621 138 1463 Downsample by umi automatic 138 1463 138 1463 nan nan
IsotypeUsage P8-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3555 35039 812 2016 Filter [TRA] 3555 35039 1914 18753 Filter stops in CDR3, OOF in CDR3 1914 18753 1653 16546 Downsample by umi automatic 1653 16546 812 2016 nan nan
IsotypeUsage P22-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2311 21151 562 2016 Filter [TRA] 2311 21151 1156 10936 Filter stops in CDR3, OOF in CDR3 1156 10936 946 9521 Downsample by umi automatic 946 9521 562 2016 nan nan
IsotypeUsage P21-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 635 9672 217 2016 Filter [TRA] 635 9672 305 5202 Filter stops in CDR3, OOF in CDR3 305 5202 267 4735 Downsample by umi automatic 267 4735 217 2016 nan nan
IsotypeUsage P18-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2160 36838 607 2016 Filter [TRA] 2160 36838 1284 25604 Filter stops in CDR3, OOF in CDR3 1284 25604 1135 24185 Downsample by umi automatic 1135 24185 607 2016 nan nan
IsotypeUsage P7-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 985 24058 292 2016 Filter [TRA] 985 24058 501 12296 Filter stops in CDR3, OOF in CDR3 501 12296 445 11576 Downsample by umi automatic 445 11576 292 2016 nan nan
IsotypeUsage P15-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 874 13573 223 2016 Filter [TRA] 874 13573 317 5182 Filter stops in CDR3, OOF in CDR3 317 5182 262 4603 Downsample by umi automatic 262 4603 223 2016 nan nan
IsotypeUsage P16-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 747 19373 232 2016 Filter [TRA] 747 19373 342 8091 Filter stops in CDR3, OOF in CDR3 342 8091 272 7017 Downsample by umi automatic 272 7017 232 2016 nan nan
IsotypeUsage P19-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 5664 31152 1157 2016 Filter [TRA] 5664 31152 3625 20596 Filter stops in CDR3, OOF in CDR3 3625 20596 3046 17766 Downsample by umi automatic 3046 17766 1157 2016 nan nan
IsotypeUsage P19-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 705 36623 218 2016 Filter [TRA] 705 36623 348 16970 Filter stops in CDR3, OOF in CDR3 348 16970 266 13616 Downsample by umi automatic 266 13616 218 2016 nan nan
IsotypeUsage P15-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1132 18243 288 2016 Filter [TRA] 1132 18243 471 8159 Filter stops in CDR3, OOF in CDR3 471 8159 375 7130 Downsample by umi automatic 375 7130 288 2016 nan nan
IsotypeUsage P23-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1042 15910 307 2016 Filter [TRA] 1042 15910 626 11323 Filter stops in CDR3, OOF in CDR3 626 11323 491 9848 Downsample by umi automatic 491 9848 307 2016 nan nan
IsotypeUsage P14-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1533 19460 433 2016 Filter [TRA] 1533 19460 700 8413 Filter stops in CDR3, OOF in CDR3 700 8413 529 6712 Downsample by umi automatic 529 6712 433 2016 nan nan
IsotypeUsage P21-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 322 3195 152 1134 Filter [TRA] 322 3195 168 1263 Filter stops in CDR3, OOF in CDR3 168 1263 152 1134 Downsample by umi automatic 152 1134 152 1134 nan nan
IsotypeUsage P21-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 604 12389 191 2016 Filter [TRA] 604 12389 296 6443 Filter stops in CDR3, OOF in CDR3 296 6443 259 5661 Downsample by umi automatic 259 5661 191 2016 nan nan
IsotypeUsage P8-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1639 27706 345 2016 Filter [TRA] 1639 27706 882 15118 Filter stops in CDR3, OOF in CDR3 882 15118 740 14283 Downsample by umi automatic 740 14283 345 2016 nan nan
IsotypeUsage P14-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 312 7498 97 2016 Filter [TRA] 312 7498 122 2849 Filter stops in CDR3, OOF in CDR3 122 2849 99 2073 Downsample by umi automatic 99 2073 97 2016 nan nan
IsotypeUsage P18-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 726 10685 283 2016 Filter [TRA] 726 10685 420 7426 Filter stops in CDR3, OOF in CDR3 420 7426 365 6921 Downsample by umi automatic 365 6921 283 2016 nan nan
IsotypeUsage P14-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4913 38152 812 2016 Filter [TRA] 4913 38152 2794 23198 Filter stops in CDR3, OOF in CDR3 2794 23198 2473 21699 Downsample by umi automatic 2473 21699 812 2016 nan nan
IsotypeUsage P7-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1681 47083 366 2016 Filter [TRA] 1681 47083 918 21571 Filter stops in CDR3, OOF in CDR3 918 21571 781 19605 Downsample by umi automatic 781 19605 366 2016 nan nan
IsotypeUsage P16-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1252 22292 368 2016 Filter [TRA] 1252 22292 619 8996 Filter stops in CDR3, OOF in CDR3 619 8996 498 7580 Downsample by umi automatic 498 7580 368 2016 nan nan
IsotypeUsage P8-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 571 14348 187 2016 Filter [TRA] 571 14348 276 6486 Filter stops in CDR3, OOF in CDR3 276 6486 231 6117 Downsample by umi automatic 231 6117 187 2016 nan nan
IsotypeUsage P19-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 863 19338 182 2016 Filter [TRA] 863 19338 394 10415 Filter stops in CDR3, OOF in CDR3 394 10415 323 9915 Downsample by umi automatic 323 9915 182 2016 nan nan
IsotypeUsage P18-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1871 24519 514 2016 Filter [TRA] 1871 24519 1085 17458 Filter stops in CDR3, OOF in CDR3 1085 17458 952 16490 Downsample by umi automatic 952 16490 514 2016 nan nan
IsotypeUsage P15-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1206 13963 402 2016 Filter [TRA] 1206 13963 627 7619 Filter stops in CDR3, OOF in CDR3 627 7619 543 7061 Downsample by umi automatic 543 7061 402 2016 nan nan
IsotypeUsage P5-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3223 18148 873 2016 Filter [TRA] 3223 18148 1755 10270 Filter stops in CDR3, OOF in CDR3 1755 10270 1491 8805 Downsample by umi automatic 1491 8805 873 2016 nan nan
IsotypeUsage P23-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 416 15776 141 2016 Filter [TRA] 416 15776 223 9081 Filter stops in CDR3, OOF in CDR3 223 9081 181 7764 Downsample by umi automatic 181 7764 141 2016 nan nan
IsotypeUsage P5-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1787 22667 437 2016 Filter [TRA] 1787 22667 892 12934 Filter stops in CDR3, OOF in CDR3 892 12934 750 12099 Downsample by umi automatic 750 12099 437 2016 nan nan
IsotypeUsage P16-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 493 11795 131 2016 Filter [TRA] 493 11795 204 4121 Filter stops in CDR3, OOF in CDR3 204 4121 173 3905 Downsample by umi automatic 173 3905 131 2016 nan nan
IsotypeUsage P18-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2538 69555 386 2016 Filter [TRA] 2538 69555 1285 39291 Filter stops in CDR3, OOF in CDR3 1285 39291 1102 36853 Downsample by umi automatic 1102 36853 386 2016 nan nan
IsotypeUsage P7-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2529 68105 286 2016 Filter [TRA] 2529 68105 1367 39894 Filter stops in CDR3, OOF in CDR3 1367 39894 1179 36468 Downsample by umi automatic 1179 36468 286 2016 nan nan
IsotypeUsage P18-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1092 16951 365 2016 Filter [TRA] 1092 16951 629 11506 Filter stops in CDR3, OOF in CDR3 629 11506 519 10157 Downsample by umi automatic 519 10157 365 2016 nan nan
IsotypeUsage P19-M1-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 427 9195 145 2016 Filter [TRA] 427 9195 221 4852 Filter stops in CDR3, OOF in CDR3 221 4852 170 4070 Downsample by umi automatic 170 4070 145 2016 nan nan
IsotypeUsage P15-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 997 11499 280 2016 Filter [TRA] 997 11499 389 4310 Filter stops in CDR3, OOF in CDR3 389 4310 313 3508 Downsample by umi automatic 313 3508 280 2016 nan nan
IsotypeUsage P14-T0-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 405 13665 98 2016 Filter [TRA] 405 13665 163 4616 Filter stops in CDR3, OOF in CDR3 163 4616 110 3463 Downsample by umi automatic 110 3463 98 2016 nan nan
JSegmentUsage P14-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 704 9455 215 2016 Filter [TRA] 704 9455 279 3442 Filter stops in CDR3, OOF in CDR3 279 3442 242 3048 Downsample by umi automatic 242 3048 215 2016 nan nan
JSegmentUsage P16-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 581 9645 132 2016 Filter [TRA] 581 9645 228 4514 Filter stops in CDR3, OOF in CDR3 228 4514 172 3994 Downsample by umi automatic 172 3994 132 2016 nan nan
JSegmentUsage P21-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1076 11773 331 2016 Filter [TRA] 1076 11773 520 5325 Filter stops in CDR3, OOF in CDR3 520 5325 458 4933 Downsample by umi automatic 458 4933 331 2016 nan nan
JSegmentUsage P23-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 80 579 36 180 Filter [TRA] 80 579 40 184 Filter stops in CDR3, OOF in CDR3 40 184 36 180 Downsample by umi automatic 36 180 36 180 nan nan
JSegmentUsage P19-M2PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2090 45179 317 2016 Filter [TRA] 2090 45179 1147 30548 Filter stops in CDR3, OOF in CDR3 1147 30548 987 29429 Downsample by umi automatic 987 29429 317 2016 nan nan
JSegmentUsage P21-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 960 19855 280 2016 Filter [TRA] 960 19855 510 11141 Filter stops in CDR3, OOF in CDR3 510 11141 429 10081 Downsample by umi automatic 429 10081 280 2016 nan nan
JSegmentUsage P5-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 789 31519 167 2016 Filter [TRA] 789 31519 400 17067 Filter stops in CDR3, OOF in CDR3 400 17067 352 15973 Downsample by umi automatic 352 15973 167 2016 nan nan
JSegmentUsage P8-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1209 37998 258 2016 Filter [TRA] 1209 37998 655 21649 Filter stops in CDR3, OOF in CDR3 655 21649 561 20541 Downsample by umi automatic 561 20541 258 2016 nan nan
JSegmentUsage P18-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2066 92011 452 2016 Filter [TRA] 2066 92011 1222 63269 Filter stops in CDR3, OOF in CDR3 1222 63269 1033 59264 Downsample by umi automatic 1033 59264 452 2016 nan nan
JSegmentUsage P16-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 331 10152 75 2016 Filter [TRA] 331 10152 120 4312 Filter stops in CDR3, OOF in CDR3 120 4312 93 3666 Downsample by umi automatic 93 3666 75 2016 nan nan
JSegmentUsage P22-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 258 7836 88 2016 Filter [TRA] 258 7836 124 3923 Filter stops in CDR3, OOF in CDR3 124 3923 99 3177 Downsample by umi automatic 99 3177 88 2016 nan nan
JSegmentUsage P18-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1709 31160 395 2016 Filter [TRA] 1709 31160 964 22048 Filter stops in CDR3, OOF in CDR3 964 22048 848 21055 Downsample by umi automatic 848 21055 395 2016 nan nan
JSegmentUsage P5-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 669 8934 262 2016 Filter [TRA] 669 8934 341 5148 Filter stops in CDR3, OOF in CDR3 341 5148 297 4553 Downsample by umi automatic 297 4553 262 2016 nan nan
JSegmentUsage P22-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1593 50054 301 2016 Filter [TRA] 1593 50054 873 32294 Filter stops in CDR3, OOF in CDR3 873 32294 721 29971 Downsample by umi automatic 721 29971 301 2016 nan nan
JSegmentUsage P16-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 880 15352 249 2016 Filter [TRA] 880 15352 445 6911 Filter stops in CDR3, OOF in CDR3 445 6911 355 6074 Downsample by umi automatic 355 6074 249 2016 nan nan
JSegmentUsage P7-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1720 33563 360 2016 Filter [TRA] 1720 33563 986 22404 Filter stops in CDR3, OOF in CDR3 986 22404 864 20675 Downsample by umi automatic 864 20675 360 2016 nan nan
JSegmentUsage P15-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2401 18323 745 2016 Filter [TRA] 2401 18323 1355 10634 Filter stops in CDR3, OOF in CDR3 1355 10634 1221 9710 Downsample by umi automatic 1221 9710 745 2016 nan nan
JSegmentUsage P16-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1264 20091 360 2016 Filter [TRA] 1264 20091 705 10909 Filter stops in CDR3, OOF in CDR3 705 10909 619 10226 Downsample by umi automatic 619 10226 360 2016 nan nan
JSegmentUsage P15-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2596 15442 829 2016 Filter [TRA] 2596 15442 1406 8725 Filter stops in CDR3, OOF in CDR3 1406 8725 1241 7797 Downsample by umi automatic 1241 7797 829 2016 nan nan
JSegmentUsage P14-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1631 14813 520 2016 Filter [TRA] 1631 14813 909 7948 Filter stops in CDR3, OOF in CDR3 909 7948 795 7429 Downsample by umi automatic 795 7429 520 2016 nan nan
JSegmentUsage P7-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 708 16707 153 2016 Filter [TRA] 708 16707 366 10791 Filter stops in CDR3, OOF in CDR3 366 10791 306 10337 Downsample by umi automatic 306 10337 153 2016 nan nan
JSegmentUsage P7-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 3854 40098 549 2016 Filter [TRA] 3854 40098 2133 23481 Filter stops in CDR3, OOF in CDR3 2133 23481 1887 21846 Downsample by umi automatic 1887 21846 549 2016 nan nan
JSegmentUsage P18-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1815 31892 388 2016 Filter [TRA] 1815 31892 1027 20669 Filter stops in CDR3, OOF in CDR3 1027 20669 883 19505 Downsample by umi automatic 883 19505 388 2016 nan nan
JSegmentUsage P15-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 749 15816 239 2016 Filter [TRA] 749 15816 399 10978 Filter stops in CDR3, OOF in CDR3 399 10978 360 10654 Downsample by umi automatic 360 10654 239 2016 nan nan
JSegmentUsage P8-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 836 20403 223 2016 Filter [TRA] 836 20403 416 12545 Filter stops in CDR3, OOF in CDR3 416 12545 359 11838 Downsample by umi automatic 359 11838 223 2016 nan nan
JSegmentUsage P19-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2532 67648 333 2016 Filter [TRA] 2532 67648 1394 40352 Filter stops in CDR3, OOF in CDR3 1394 40352 1174 37896 Downsample by umi automatic 1174 37896 333 2016 nan nan
JSegmentUsage P14-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1202 15201 294 2016 Filter [TRA] 1202 15201 516 6933 Filter stops in CDR3, OOF in CDR3 516 6933 402 5790 Downsample by umi automatic 402 5790 294 2016 nan nan
JSegmentUsage P5-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2745 24504 633 2016 Filter [TRA] 2745 24504 1393 12912 Filter stops in CDR3, OOF in CDR3 1393 12912 1264 12134 Downsample by umi automatic 1264 12134 633 2016 nan nan
JSegmentUsage P22-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2380 53898 491 2016 Filter [TRA] 2380 53898 1294 31762 Filter stops in CDR3, OOF in CDR3 1294 31762 1099 29827 Downsample by umi automatic 1099 29827 491 2016 nan nan
JSegmentUsage P21-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1041 23068 316 2016 Filter [TRA] 1041 23068 519 11192 Filter stops in CDR3, OOF in CDR3 519 11192 456 10288 Downsample by umi automatic 456 10288 316 2016 nan nan
JSegmentUsage P19-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2474 30803 700 2016 Filter [TRA] 2474 30803 1289 17343 Filter stops in CDR3, OOF in CDR3 1289 17343 1044 14534 Downsample by umi automatic 1044 14534 700 2016 nan nan
JSegmentUsage P5-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 869 29425 225 2016 Filter [TRA] 869 29425 442 11193 Filter stops in CDR3, OOF in CDR3 442 11193 388 10506 Downsample by umi automatic 388 10506 225 2016 nan nan
JSegmentUsage P22-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 184 3144 69 1459 Filter [TRA] 184 3144 93 1827 Filter stops in CDR3, OOF in CDR3 93 1827 69 1459 Downsample by umi automatic 69 1459 69 1459 nan nan
JSegmentUsage P8-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1756 30662 329 2016 Filter [TRA] 1756 30662 963 20086 Filter stops in CDR3, OOF in CDR3 963 20086 824 18907 Downsample by umi automatic 824 18907 329 2016 nan nan
JSegmentUsage P22-M2-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 4777 44762 1030 2016 Filter [TRA] 4777 44762 2873 29196 Filter stops in CDR3, OOF in CDR3 2873 29196 2563 26610 Downsample by umi automatic 2563 26610 1030 2016 nan nan
JSegmentUsage P22-T0-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2739 38839 744 2016 Filter [TRA] 2739 38839 1500 22460 Filter stops in CDR3, OOF in CDR3 1500 22460 1277 19749 Downsample by umi automatic 1277 19749 744 2016 nan nan
JSegmentUsage P19-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1122 19814 326 2016 Filter [TRA] 1122 19814 646 13010 Filter stops in CDR3, OOF in CDR3 646 13010 512 11091 Downsample by umi automatic 512 11091 326 2016 nan nan
JSegmentUsage P7-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2653 59321 560 2016 Filter [TRA] 2653 59321 1469 32629 Filter stops in CDR3, OOF in CDR3 1469 32629 1287 30146 Downsample by umi automatic 1287 30146 560 2016 nan nan
JSegmentUsage P16-T0-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 741 22542 172 2016 Filter [TRA] 741 22542 362 11332 Filter stops in CDR3, OOF in CDR3 362 11332 307 10680 Downsample by umi automatic 307 10680 172 2016 nan nan
JSegmentUsage P16-M2-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 196 632 69 246 Filter [TRA] 196 632 82 271 Filter stops in CDR3, OOF in CDR3 82 271 69 246 Downsample by umi automatic 69 246 69 246 nan nan
JSegmentUsage P8-M2-PD1.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 192 479 73 189 Filter [TRA] 192 479 82 201 Filter stops in CDR3, OOF in CDR3 82 201 73 189 Downsample by umi automatic 73 189 73 189 nan nan
JSegmentUsage P22-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 866 17842 289 2016 Filter [TRA] 866 17842 470 10484 Filter stops in CDR3, OOF in CDR3 470 10484 399 9800 Downsample by umi automatic 399 9800 289 2016 nan nan
JSegmentUsage P6-M1-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 793 14668 250 2016 Filter [TRA] 793 14668 348 5789 Filter stops in CDR3, OOF in CDR3 348 5789 282 4623 Downsample by umi automatic 282 4623 250 2016 nan nan
JSegmentUsage P6-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1136 9292 420 2016 Filter [TRA] 1136 9292 561 4134 Filter stops in CDR3, OOF in CDR3 561 4134 455 3565 Downsample by umi automatic 455 3565 420 2016 nan nan
JSegmentUsage P8-M1-DNEG.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2947 24377 809 2016 Filter [TRA] 2947 24377 1726 14772 Filter stops in CDR3, OOF in CDR3 1726 14772 1509 13347 Downsample by umi automatic 1509 13347 809 2016 nan nan
JSegmentUsage P6-M1-TIGIT.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 729 11526 254 2016 Filter [TRA] 729 11526 374 4605 Filter stops in CDR3, OOF in CDR3 374 4605 308 3944 Downsample by umi automatic 308 3944 254 2016 nan nan
JSegmentUsage P8-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1510 24700 345 2016 Filter [TRA] 1510 24700 794 15444 Filter stops in CDR3, OOF in CDR3 794 15444 690 14490 Downsample by umi automatic 690 14490 345 2016 nan nan
JSegmentUsage P6-T0-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 1195 21037 282 2016 Filter [TRA] 1195 21037 508 10155 Filter stops in CDR3, OOF in CDR3 508 10155 437 9283 Downsample by umi automatic 437 9283 282 2016 nan nan
JSegmentUsage P15-M2-DPOS.clns Filter [TRA] Filter stops in CDR3, OOF in CDR3 Downsample by umi automatic 2263 26683 582 2016 Filter [TRA] 2263 26683 1306 16044