Skip to content

Exporting formatted alignments and clonotypes

MiXCR is able to export alignments and clonotypes as pretty formatted human-readable text for manual analysis. This is useful both to inspect alignments and to facilitate optimization of analysis parameters and library preparation protocol.

Raw alignments

mixcr exportAlignmentsPretty 
    [--top] 
    [--gene] 
    [--limit-before <n>] 
    [--limit <n>] 
    [--chains <chains>] 
    [--skip <n>] 
    [--cdr3-equals <seq>] 
    [--feature <gene_feature>] 
    [--read-contains <seq>] 
    [--filter <s>] 
    [--descriptions] 
    [--read-ids <id>]... 
    [--clone-ids <id>]... 
    [--force-overwrite] 
    [--no-warnings] 
    [--verbose] 
    [--help] 
    alignments.(vdjca|clna) [output.txt]
Exports pretty formatted alignments from .vdjca file.

alignments.(vdjca|clna)
Path to input file with alignments.
[output.txt]
Path where to write export. Will write to output if omitted.
-t, --top
Output only top hits
-a, --gene
Output full gene sequence
-b, --limit-before <n>
Limit number of alignments before filtering
-n, --limit <n>
Limit number of filtered alignments; no more than N alignments will be outputted
-s, --skip <n>
Number of output alignments to skip
-c, --chains <chains>
Filter export to a specific protein chain gene (e.g. TRA or IGH). Default: ALL
-e, --cdr3-equals <seq>
Output only alignments where CDR3 exactly equals to given sequence
-g, --feature <gene_feature>
Output only alignments which contain a corresponding gene feature
-r, --read-contains <seq>
Output only alignments where target read contains a given substring
--filter <s>
Custom filter
-d, --descriptions
Print read descriptions
-i, --read-ids <id>
List of read ids to export
--clone-ids <id>
List of clone ids to export
-f, --force-overwrite
Force overwrite of output file(s).
-nw, --no-warnings
Suppress all warning messages.
--verbose
Verbose warning messages.
-h, --help
Show this help message and exit.

Example:

> mixcr exportAlignmentsPretty --skip 1000 --limit 10 input.vdjca
this will export 10 results after skipping the first 1000 records. Skipping earlier records is often useful because the first sequences in a fastq file may have lower than average read quality.

Pretty alignments have the following structure:


  >>> Read id: 1

                                                      5'UTR><L1                               
   Quality    88888888888888888888888887888888888888888888888888888888888888888888888887888878
   Target0  0 AAGGCCTTTCCACTTGGTGATCAGCACTGAGCACAGAGGACTCACCATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTG 79
IGHV3-7*00 54 aaggcctttccacttggtgatcagcactgagcacagaggactcaccatggaAttggggctgagctgggttttccttgttg 133

                        L1><L2     L2><FR1                                                     
   Quality     88888888887888888888888888888889989989989889999997999999989999999999999999999899
   Target0  80 CTATTTTAGAAGGTGTCCAGTGTGAGGTGAAGTTGGTGGAGTCTGGGGGAGGCCTGGTCCAGCCTGGGGGGTCCCTGAGA 159
IGHV3-7*00 134 ctattttagaaggtgtccagtgtgaggtgCagCtggtggagtctgggggaggcTtggtccagcctggggggtccctgaga 213

                             FR1><CDR1              CDR1><FR2                                  
   Quality     999999999999999999999999999999999999999999999 9999999999999999999999999999999999
   Target0 160 CTCTCCTGTGAAGCCTCCGGATTCACCTTTAGTAGTTATTGGATG-GCATGGGTCCGCCAGGGTCCAGGGCAGGGGCTGG 238
IGHV3-7*00 214 ctctcctgtgCagcctcTggattcacctttagtagCtattggatgAgc-tgggtccgccaggCtccagggAaggggctgg 292

                         FR2><CDR2              CDR2><FR3                                      
   Quality     99999999999999999999999999999999999799999999999999999999999999998999899898999999
   Target0 239 AATGGGTGGGCAACATAAGGCCGGATGGAAGTGAGAGTTGGTACTTGGAGTCTGTGATGGGGCGATTCATGATATCTAGA 318
IGHV3-7*00 293 aGtgggtggCcaacataaAgcAAgatggaagtgagaAAtACtaTGtggaCtctgtgaAgggCcgattcaCCatCtcCaga 372

                                                                                 FR3><CDR3      
    Quality     99899899999999988989999889979988888888878878788888888878888888778788888888878888
    Target0 319 GACAACGCCAAGAAGTCACTTTATCTGCAAATGGACAGCCTGAGAGTCGAGGACACGGCCGTCTATTATTGTGCGACTTC 398
 IGHV3-7*00 373 gacaacgccaagaaCtcactGtatctgcaaatgAacagcctgagagCcgaggacacggcTgtGtattaCtgtgcga     448
IGHD3-10*00  12                                                                              ttc 14

                                 CDR3><FR4                                                      
    Quality     88888788888888888888888787788777887787777877777877787787877878788788777767778788
    Target0 399 GGAGGAGCCGGAGGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCGGCTTCCACCAAGGGCCCATCGGTCTTCC 478
IGHD3-10*00  15 gg-ggag                                                                          20
   IGHJ4*00   8              gactactggggccagggaAccctggtcaccgtctcctc                              45
   IGHG4*00   0                                                      cttccaccaagggcccatcggtcttcc 26
   IGHG3*00   0                                                      cttccaccaagggcccatcggtcttcc 26
   IGHG2*00   0                                                      cCtccaccaagggcccatcggtcttcc 26
   IGHG1*00   0                                                      cCtccaccaagggcccatcggtcttcc 26
   IGHGP*00 194                                                    AgcCtccaccaagggcccatcggtcttcc 222


 Quality     87370
 Target0 479 CCTTG 483
IGHG4*00  27 ccCtg 31
IGHG3*00  27 ccCtg 31
IGHG2*00  27 ccCtg 31
IGHG1*00  27 ccCtg 31
IGHGP*00 223 ccCtg 227

Usage of the --verbose option will produce alignments in a slightly different format:

>>> Read id: 12343    <--- Index of analysed read in input file

>>> Target sequences (input sequences):

Sequence0:   <--- Read 1 from paired-end read
Contains features: CDR1, VRegionTrimmed, L2, L, Intron, VLIntronL, FR1, Exon1,              <--- Gene features
VExon2Trimmed                                                                                    found in read 1

    0 TCTTGGGGGATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAACTGGGTTTTCCTCGTTGCT 79  <--- Sequyence & quality 
      FGGEGGGGGDG8F78CFC6CEFF<,CFG9EED,6,CFCC<EEGFG,CE:CCAFFGGC87CEF?A?FBC@FGGFG>B,FC9          of read 1

   80 CTATTAAGAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGTGGCGTGTTCCAGCCTGGGGGGTCCGTGAGACT 159
      F9,A,95AFE,B?,E,C,9AC<FGA<EE5??,A,A<:=:E,=B8C7+++8,++@+,885=D7:@8E+:5*1**11**++<
  160 CTCCTGTGCAGCGTCGGGATGCACATCATGGAGCTATGGCCAGCCCTGGGTACGCCAGGCTACAGGCCACGGGCTGGAGG 239
      <++*++0++2A:ECE5EC5**2@C+:++++++22*2:+29+*2***25/79*0299))*/)*0*0*.75)7:)1)1/)))

  240 GGGTGCGTGGTAGATGGGAA 259
      )9:.)))*1)12***-/).)

Sequence1:   <--- Read 2 from paired-end read
Contains features: JCDR3Part, DCDR3Part, DJJunction, CDR2, JRegionTrimmed, CDR3, VDJunction,
VJJunction, VCDR3Part, ShortCDR3, FR4, FR3

    0 CGAGGCAAGAGGCTGGTGTGGGTGGCGGTTATATGGTATGGTGGAAGTAATAAACACTATGCAGACCCCGTGAAGGGCCG 79
      **0*0**)2**/**5D7<15*9<5:1+*0:GF:=C>6A52++*:2+++FF>>3<++++++302**:**/<+**;:/**2+

   80 ATTCACCATCGCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAAGAGCCTGAGAGCCGAGGACACGGCTTTGT 159
      +++<0***C:2+9GGFB?,5,4,+,2F<>FC=*,,C:>,=,@,,;3<@=,3,,<3,CF?=**<>@,?3,<<:3,CC,E,@

  160 ATTACTGTGCGAGAGGTCAACAGGGTGACTATGTCTACGGTAGGGACGTCGGGGGCCAAGGGACCACGGTCACCGTCTCC 239
      ,@;FCF@+F@FGGF9FD,F>>+B:=,,=><GFCGGCFEGFF?+=B+7EF>+FFA,8F<E:,5+GDFFE,@F?,,7GGDFE

  240 TCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCTCTGCGTTGATACCACTGGCAGCTC 300
      C,FGGGEFCCGEEGGCFCC:8FGEGGGE@DFB-GFGGGGF@GFGFE<,GFCCFCAGC@CCC

>>> Gene features that can be extracted from this (paired-)read:                         <--- For paired-end reads
JCDR3Part, CDR1, VRegionTrimmed, L2, DCDR3Part, VDJTranscriptWithout5UTR, Exon2, L,           some gene features
DJJunction, Intron, FR2, CDR2, VDJRegion, JRegionTrimmed, CDR3, VDJunction, VJJunction,       can be extracted by
VLIntronL, FR1, VCDR3Part, ShortCDR3, Exon1, FR4, VExon2Trimmed, FR3                          merging sequence
                                                                                             information

>>> Alignments with V gene:

IGHV3-33*00 (total score = 1638.0) <--- Alignment of both reads with IGHV3-33
Alignment of Sequence0 (score = 899.0):   <--- Alignment of IGHV3-33 with read 1 from paired-end read
    65 ATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGA 144 <--- Germline
       ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||
     9 ATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAACTGGGTTTTCCTCGTTGCTCTATTAAGA 88  <--- Read
       DG8F78CFC6CEFF<,CFG9EED,6,CFCC<EEGFG,CE:CCAFFGGC87CEF?A?FBC@FGGFG>B,FC9F9,A,95AF     <--- Quality score

   145 GGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGC 224
       |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||| ||||||||||||||||
    89 GGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGTGGCGTGTTCCAGCCTGGGGGGTCCGTGAGACTCTCCTGTGC 168
       E,B?,E,C,9AC<FGA<EE5??,A,A<:=:E,=B8C7+++8,++@+,885=D7:@8E+:5*1**11**++<<++*++0++

   225 AGCGTCTGGATTCACCTTCA-GTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTG 300
       |||||| |||| || | ||| | |||||||||  || |||||| ||||||||| ||||| | ||||||||| |||||
   169 AGCGTCGGGATGCA-CATCATGGAGCTATGGCCAGCCCTGGGTACGCCAGGCTACAGGCCACGGGCTGGAGGGGGTG 244
       2A:ECE5EC5**2@ C+:++++++22*2:+29+*2***25/79*0299))*/)*0*0*.75)7:)1)1/))))9:.)

Alignment of Sequence1 (score = 739.0):   <--- Alignment of IGHV3-33 with read 2 from paired-end read
   279 AGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGAT 358
       ||||||| |||||| ||||||||| ||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||
     2 AGGCAAGAGGCTGGTGTGGGTGGCGGTTATATGGTATGGTGGAAGTAATAAACACTATGCAGACCCCGTGAAGGGCCGAT 81
       0*0**)2**/**5D7<15*9<5:1+*0:GF:=C>6A52++*:2+++FF>>3<++++++302**:**/<+**;:/**2+++

   359 TCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTAT 438
       |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||
    82 TCACCATCGCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAAGAGCCTGAGAGCCGAGGACACGGCTTTGTAT 161
       +<0***C:2+9GGFB?,5,4,+,2F<>FC=*,,C:>,=,@,,;3<@=,3,,<3,CF?=**<>@,?3,<<:3,CC,E,@,@

   439 TACTGTGCGAGAG 451
       |||||||||||||
   162 TACTGTGCGAGAG 174
       ;FCF@+F@FGGF9

IGHV3-30*00 (total score = 1582.0)  <--- Alternative hit for V gene
Alignment of Sequence0 (score = 885.0):
    65 ATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGA 144
       ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||
     9 ATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAACTGGGTTTTCCTCGTTGCTCTATTAAGA 88
       DG8F78CFC6CEFF<,CFG9EED,6,CFCC<EEGFG,CE:CCAFFGGC87CEF?A?FBC@FGGFG>B,FC9F9,A,95AF

   145 GGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGC 224
       |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||| ||||||||||||||||
    89 GGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGTGGCGTGTTCCAGCCTGGGGGGTCCGTGAGACTCTCCTGTGC 168
       E,B?,E,C,9AC<FGA<EE5??,A,A<:=:E,=B8C7+++8,++@+,885=D7:@8E+:5*1**11**++<<++*++0++

   225 AGCCTCTGGATTCACCTTCA-GTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTG 300
       ||| || |||| || | ||| | |||||||||  || |||||| ||||||||| ||||| | ||||||||| |||||
   169 AGCGTCGGGATGCA-CATCATGGAGCTATGGCCAGCCCTGGGTACGCCAGGCTACAGGCCACGGGCTGGAGGGGGTG 244
       2A:ECE5EC5**2@ C+:++++++22*2:+29+*2***25/79*0299))*/)*0*0*.75)7:)1)1/))))9:.)

Alignment of Sequence1 (score = 697.0):
   279 AGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGAT 358
       ||||||| |||||| ||||||||| |||||||  |||| ||||||||||||| ||||||||||| |||||||||||||||
     2 AGGCAAGAGGCTGGTGTGGGTGGCGGTTATATGGTATGGTGGAAGTAATAAACACTATGCAGACCCCGTGAAGGGCCGAT 81
       0*0**)2**/**5D7<15*9<5:1+*0:GF:=C>6A52++*:2+++FF>>3<++++++302**:**/<+**;:/**2+++

   359 TCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTAT 438
       |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||
    82 TCACCATCGCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAAGAGCCTGAGAGCCGAGGACACGGCTTTGTAT 161
       +<0***C:2+9GGFB?,5,4,+,2F<>FC=*,,C:>,=,@,,;3<@=,3,,<3,CF?=**<>@,?3,<<:3,CC,E,@,@

   439 TACTGTGCGAGAG 451
       |||||||||||||
   162 TACTGTGCGAGAG 174
       ;FCF@+F@FGGF9

>>> Alignments with D gene:

IGHD4-17*00 (total score = 40.0)
Alignment of Sequence1 (score = 40.0):
     7 GGTGACTA 14
       ||||||||
   183 GGTGACTA 190
       :=,,=><G

IGHD4-23*00 (total score = 36.0)
Alignment of Sequence1 (score = 36.0):
     0 TGACTACGGT 9
       || |||||||
   191 TGTCTACGGT 200
       FCGGCFEGFF

IGHD2-21*00 (total score = 35.0)
Alignment of Sequence1 (score = 35.0):
    13 GGTGACT 19
       |||||||
   183 GGTGACT 189
       :=,,=><

>>> Alignments with J gene:

IGHJ6*00 (total score = 172.0)
Alignment of Sequence1 (score = 172.0):
    22 GGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCA 61
       ||||||| ||||| ||||||||||||||||||||||||||
   203 GGACGTCGGGGGCCAAGGGACCACGGTCACCGTCTCCTCA 242
       =B+7EF>+FFA,8F<E:,5+GDFFE,@F?,,7GGDFEC,F

>>> Alignments with C gene:

No hits.

Clonotypes

mixcr exportClonesPretty 
    [--limitBefore <n>] 
    [--limit <n>] 
    [--skip <n>] 
    [--clone-ids <id>]... 
    [--chains <chains>] 
    [--cdr3-equals <seq>] 
    [--clonal-sequence-contains <seq>] 
    [--force-overwrite] 
    [--no-warnings] 
    [--verbose] 
    [--help] 
    clones.(clns|clna) [output.txt]
Exports pretty formatted clonotypes from .clnx files. Especially useful after assembleContigs to manually check how contig clonotypes are covered.

clones.(clns|clna)
Path to input file with clones
[output.txt]
Path where to write export. Will write to output if omitted.
-b, --limitBefore <n>
Limit number of alignments before filtering
-n, --limit <n>
Limit number of filtered alignments; no more than N alignments will be outputted
-s, --skip <n>
Number of output alignments to skip
-i, --clone-ids <id>
List of clone ids to export
-c, --chains <chains>
Filter export to a specific protein chain gene (e.g. TRA or IGH). Default: ALL
-e, --cdr3-equals <seq>
Only output clones where CDR3 (not whole clonal sequence) exactly equals to given sequence
-r, --clonal-sequence-contains <seq>
Only output clones where target clonal sequence contains sub-sequence.
-f, --force-overwrite
Force overwrite of output file(s).
-nw, --no-warnings
Suppress all warning messages.
--verbose
Verbose warning messages.
-h, --help
Show this help message and exit.